TMEM95 (NM_198154) Human Untagged Clone
CAT＃: SC307636
TMEM95 (untagged)-Human transmembrane protein 95 (TMEM95)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | UNQ9390 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_198154, the custom clone sequence may differ by one or more nucleotides
ATGTGGAGGCTGGCACTAGGCGGGGTTTTCCTGGCAGCCGCCCAGGCTTGTGTCTTCTGT CGCCTCCCAGCCCACGACTTGTCAGGCCGCCTGGCTCGGCTCTGCAGCCAGATGGAGGCC AGGCAGAAGGAATGTGGGGCCTCCCCAGACTTCTCGGCCTTTGCCTTAGATGAGGTGTCC ATGAACAAAGTCACAGAGAAGACTCACAGAGTCCTGAGGGTCATGGAAATCAAAGAGGCT GTCTCCTCACTCCCTTCATATTGGAGTTGGCTTCGAAAGACCAAGCTCCCTGAGTACACC AGGGAAGCTCTCTGTCCCCCCGCCTGCCCGTTGCCTCTGCTGTCTCCTGCAGGGGGCAGC ACCACGCTGTACAACTGCTCCACCTGCAAGGGGACGGAGGTGTCCTGCTGGCCCCGAAAG CGCTGCTTCCCAGGAAGTCAGGATCTTTGGGAAGCCAAGATTCTGCTCCTCTCCATCTTC GGAGCTTTCCTGCTTCTGGGTGTTCTGAGCCTCCTGGTGGAGTCCCACCACCTCCAAGCA AAAAGTGGCTTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_198154 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198154.1, NP_937797.1 |
| RefSeq Size | 1169 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 339168 |
| UniProt ID | Q3KNT9 |
| Gene Summary | Sperm protein required for fusion of sperm with the egg membrane during fertilization.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222524 | TMEM95 (Myc-DDK-tagged)-Human transmembrane protein 95 (TMEM95) |
CNY 2400.00 |
|
| RC222524L3 | Lenti-ORF clone of TMEM95 (Myc-DDK-tagged)-Human transmembrane protein 95 (TMEM95) |
CNY 5890.00 |
|
| RC222524L4 | Lenti-ORF clone of TMEM95 (mGFP-tagged)-Human transmembrane protein 95 (TMEM95) |
CNY 5890.00 |
|
| RG222524 | TMEM95 (tGFP-tagged) - Human transmembrane protein 95 (TMEM95) |
CNY 4370.00 |
