MAX (NM_197957) Human Untagged Clone

CAT#: SC307618

MAX (untagged)-Human MYC associated factor X (MAX), transcript variant 6



  "NM_197957" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MAX mouse monoclonal antibody,clone OTI14G1
    • 100 ul

CNY 1999.00
CNY 3600.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHd4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_197957 edited
CTCGGCTTGTTGTTGTCGGTGACTTCCCCCTCCCCTTCACCCCTTCCCCTCCCCGCCGCC
GCTGCAGTGGCCGCTCCCTGGGCCGTAGGAAATGAGCGATAACGATGACATCGAGGTGGA
GAGCGACGAAGAGCAACCGAGGTTTCAATCTGCGGCTGACAAACGGGCTCATCATAATGC
ACTGGAACGAAAACGTAGGGACCACATCAAAGACAGCTTTCACAGTTTGCGGGACTCAGT
CCCATCACTCCAAGGAGAGAAGGGAACAAAGATGAAGTTAACCCTCCCACCTGTCTTTCC
TTATGAACACTTGCCTTTTCCAACTGTTTTCTGCCATGGCTAATC
Restriction Sites Please inquire     
ACCN NM_197957
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_197957.2, NP_932061.1
RefSeq Size 452 bp
RefSeq ORF 252 bp
Locus ID 4149
UniProt ID P61244
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway, Pathways in cancer, Small cell lung cancer
Gene Summary The protein encoded by this gene is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell proliferation, differentiation and apoptosis. The homodimers and heterodimers compete for a common DNA target site (the E box) and rearrangement among these dimer forms provides a complex system of transcriptional regulation. Mutations of this gene have been reported to be associated with hereditary pheochromocytoma. A pseudogene of this gene is located on the long arm of chromosome 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (6) lacks an alternate in-frame exon in the coding region and includes an alternate 3' terminal exon, compared to variant 1. It encodes isoform f which is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...