IKZF3 (NM_183229) Human Untagged Clone
CAT#: SC307558
IKZF3 (untagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 3
CNY 7510.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AIO; AIOLOS; ZNFN1A3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_183229, the custom clone sequence may differ by one or more nucleotides
ATGGAAGATATACAAACAAATGCGGAACTGAAAAGCACTCAGGAGCAGTCTGTGCCCGCA GAAAGTGCAGCGGTTTTGAATGACTACAGTTTAACCAAATCTCATGAAATGGAAAATGTG GACAGTGGAGAAGGCCCAGCCAATGAAGATGAAGACATAGGAGATGATTCAATGAAAGTG AAAGATGAATACAGTGAAAGAGATGAGAATGTTTTAAAGTCAGAACCCATGGGAAATGCA GAAGAGCCTGAAATCCCTTACAGCTATTCAAGAGAATATAATGAATATGAAAACATTAAG TTGGAGAGACATGTTGTCTCATTCGATAGTAGCAGGCCAACCAGTGGAAAGATGAACTGC GATGTGTGTGGATTATCCTGCATCAGCTTCAATGTCTTAATGGTTCATAAGCGAAGCCAT ACTGGTGAACGCCCATTCCAGTGTAATCAGTGTGGGGCATCTTTTACTCAGAAAGGTAAC CTCCTCCGCCACATTAAACTGCACACAGGGGAAAAACCTTTTAAGTGTCACCTCTGCAAC TATGCATGCCAAAGAAGAGATGCGCTCACGGGGCATCTTAGGACACATTCTGCAAGTGCG GAGGCAAGACACATCAAAGCAGAGATGGGAAGTGAAAGAGCTCTCGTACTGGACAGATTA GCAAGCAATGTGGCAAAACGAAAAAGCTCAATGCCTCAGAAATTCATTGGTGAGAAGCGC CACTGCTTTGATGTCAACTATAATTCAAGTTACATGTATGAGAAAGAGAGTGAGCTCATA CAGACCCGCATGATGGACCAAGCCATCAATAACGCCATCAGCTATCTTGGCGCCGAAGCC CTGCGCCCCTTGGTCCAGACACCGCCTGCTCCCACCTCGGAGATGGTTCCAGTTATCAGC AGCATGTATCCCATAGCCCTCACCCGGGCTGAGATGTCAAACGGTGCCCCTCAAGAGCTG GAAAAGAAAAGCATCCACCTTCCAGAGAAGAGCGTGCCTTCTGAGAGAGGCCTCTCTCCC AACAATAGTGGCCACGACTCCACGGACACTGACAGCAACCATGAAGAACGCCAGAATCAC ATCTATCAGCAAAATCACATGGTCCTGTCTCGGGCCCGCAATGGGATGCCACTTCTGAAG GAGGTTCCCCGCTCTTACGAACTCCTCAAGCCCCCGCCCATCTGCCCAAGAGACTCCGTC AAAGTGATCAACAAGGAAGGGGAGGTGATGGATGTGTATCGGTGTGACCACTGCCGCGTC CTCTTCCTGGACTATGTGATGTTCACGATTCACATGGGCTGCCACGGCTTCCGTGACCCT TTCGAGTGTAACATGTGTGGATATCGAAGCCATGATCGGTATGAGTTCTCGTCTCACATA GCCAGAGGAGAACACAGAGCCCTGCTGAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_183229 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_183229.1, NP_899052.1 |
RefSeq Size | 2320 bp |
RefSeq ORF | 1413 bp |
Locus ID | 22806 |
UniProt ID | Q9UKT9 |
Gene Summary | This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (3, also known as Aio-del5) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219693 | IKZF3 (Myc-DDK-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 3 |
CNY 4180.00 |
|
RC219693L3 | Lenti-ORF clone of IKZF3 (Myc-DDK-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 3 |
CNY 6080.00 |
|
RC219693L4 | Lenti-ORF clone of IKZF3 (mGFP-tagged)-Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 3 |
CNY 6080.00 |
|
RG219693 | IKZF3 (tGFP-tagged) - Human IKAROS family zinc finger 3 (Aiolos) (IKZF3), transcript variant 3 |
CNY 4560.00 |