Uroplakin IIIB (UPK3B) (NM_182684) Human Untagged Clone

CAT#: SC307483

UPK3B (untagged)-Human uroplakin 3B (UPK3B), transcript variant 2



  "NM_182684" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


UPK3B Antibody - C-terminal region
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms P35; UP3B; UPIIIB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307483 representing NM_182684.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCTACCCTGGGGGCAGCCTCACCTAGGGCTGCAGATGCTCCTCCTGGCATTGAACTGTCTCCGG
CCCAGCCTGAGCCTGGAGCTGGTGCCCTACACACCACAGATAACAGCTTGGGACCTGGAAGGGAAGGTC
ACAGCCACCACCTTCTCCCTGGAGCAGCCGCGCTGTGTCTTCGATGGGCTTGCCAGCGCCAGCGATACC
GTCTGGCTCGTGGTGGCCTTCAGCAATGCCTCCAGGGGCTTCCAGAACCCGGAGACACTGGCTGACATT
CCGGCCTCCCCACAGCTGCTGACCGATGGCCACTACATGACGCTGCCCCTGTCTCCGGACCAGCTGCCC
TGTGGCGACCCCATGGCGGGCAGCGGAGGCGCCCCCGTGCTGCGGGTGGGCCATGACCACGGCTGCCAC
CAGCAGCCCTTCTGCAACGCGCCCCTCCCTGGCCCTGGACCCTATCGGGTGAAGTTCCTCCTGATGGAC
ACCAGGGGCTCACCCAGGGCTGAGACCAAGTGGTCAGACCCCATCACTCTCCACCAAGGGAAGACCCCC
GGATCCATCGACACCTGGCCAGGGCGGCGAAGTGGCAGCATGATCGTCATTACCTCCATCCTCTCTTCT
CTGGCCGGCCTCCTACTCTTGGCCTTCTTGGCAGCCTCTACCATGCGCTTCTCCAGCCTGTGGTGGCCG
GAGGAGGCCCCGGAGCAGCTGCGGATCGGCTCCTTCATGGGCAAGCGCTACATGACCCACCACATCCCA
CCCAGCGAGGCCGCCACACTGCCGGTGGGCTGCAAGCCTGGCCTGGACCCCCTCCCCAGCCTCAGCCCC
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_182684
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_182684.2
RefSeq Size 1542 bp
RefSeq ORF 831 bp
Locus ID 105375355
UniProt ID Q9BT76
MW 29.7 kDa
Gene Summary UPK3B is a minor component of the apical plaques of mammalian urothelium that binds and dimerizes with uroplakin-1b (UPK1B; MIM 602380), one of the major conserved urothelium membrane proteins. The other major conserved integral membrane proteins of urothelial plaques are UPK1A (MIM 611557), UPK2 (MIM 611558), and UPK3A (MIM 611559) (Deng et al., 2002 [PubMed 12446744]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) is alternatively spliced at the 5' end and contains an additional internal exon, which causes a frame-shift compared to variant 1. The resulting isoform (b) lacks a protein segment in the N-terminal region and has a distinct C-terminus compared to isoform a. This variant is annotated on the ALT_REF_LOCI_1 alternate haplotype of the GRCh38 human reference genome assembly.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...