SPC24 (NM_182513) Human Untagged Clone
CAT#: SC307413
SPC24 (untagged)-Human SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (SPC24)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SPBC24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307413 representing NM_182513.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGCCTTCCGCGACATAGAGGAGGTGAGCCAGGGGCTGCTCAGCCTGCTGGGCGCCAACCGCGCG GAGGCGCAGCAGCGACGGCTGCTGGGGCGCCACGAGCAGGTGGTGGAGCGGCTGCTGGAAACGCAAGAC GGTGCCGAGAAGCAGCTGCGAGAGATCCTCACCATGGAGAAGGAAGTGGCCCAGAGCCTTCTCAATGCG AAGGAGCAGGTGCACCAGGGAGGCGTGGAGCTGCAGCAGCTGGAAGCTGGGCTTCAGGAGGCTGGGGAG GAGGACACCCGTCTGAAGGCCAGCCTCCTTCAGCTCACCAGAGAGCTGGAAGAGCTCAAGGAGATTGAG GCGGATCTGGAGCGACAGGAGAAGGAGGTCGACGAGGACACGACAGTCACAATCCCCTCGGCCGTGTAC GTGGCTCAACTTTACCACCAAGTTAGTAAAATTGAGTGGGATTATGAGTGTGAGCCAGGGATGGTCAAA GGCATCCATCATGGCCCCAGTGTGGCCCAGCCCATCCACCTGGACAGCACCCAGCTCTCCAGGAAATTC ATCAGCGACTACCTCTGGAGTCTGGTGGACACCGAGTGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_182513 |
Insert Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_182513.3 |
RefSeq Size | 2319 bp |
RefSeq ORF | 594 bp |
Locus ID | 147841 |
UniProt ID | Q8NBT2 |
Protein Families | Druggable Genome |
MW | 22.4 kDa |
Gene Summary | Acts as a component of the essential kinetochore-associated NDC80 complex, which is required for chromosome segregation and spindle checkpoint activity (PubMed:14738735). Required for kinetochore integrity and the organization of stable microtubule binding sites in the outer plate of the kinetochore (PubMed:14738735). The NDC80 complex synergistically enhances the affinity of the SKA1 complex for microtubules and may allow the NDC80 complex to track depolymerizing microtubules (PubMed:23085020).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211241 | SPC24 (Myc-DDK-tagged)-Human SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (SPC24) |
CNY 2400.00 |
|
RC211241L3 | Lenti ORF clone of Human SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (SPC24), Myc-DDK-tagged |
CNY 5890.00 |
|
RC211241L4 | Lenti ORF clone of Human SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (SPC24), mGFP tagged |
CNY 5890.00 |
|
RG211241 | SPC24 (tGFP-tagged) - Human SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae) (SPC24) |
CNY 4000.00 |