GEM (NM_181702) Human Untagged Clone
CAT#: SC307348
GEM (untagged)-Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2
CNY 6270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | KIR |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307348 representing NM_181702.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTCTGAATAATGTCACCATGCGCCAGGGCACTGTGGGCATGCAGCCACAGCAGCAGCGCTGGAGC ATCCCAGCTGATGGCAGGCATCTGATGGTCCAGAAAGAGCCCCACCAGTACAGCCACCGCAACCGCCAT TCTGCTACCCCTGAGGACCACTGCCGCCGAAGCTGGTCCTCTGACTCCACAGACTCAGTCATCTCCTCT GAGTCAGGGAACACCTACTACCGAGTGGTGCTCATAGGGGAGCAGGGGGTGGGCAAGTCCACTCTGGCC AACATCTTTGCAGGTGTGCATGACAGCATGGACAGCGACTGCGAGGTGCTGGGAGAAGATACATATGAA CGAACCCTGATGGTTGATGGGGAAAGTGCAACGATTATACTCCTGGATATGTGGGAAAATAAGGGGGAA AATGAATGGCTCCATGACCACTGCATGCAGGTCGGGGACGCATACCTGATTGTCTACTCAATCACAGAC CGAGCGAGCTTCGAGAAGGCATCTGAGCTGCGAATCCAGCTCCGCAGGGCCCGGCAGACAGAGGACATT CCCATAATTTTGGTTGGCAACAAAAGTGACTTAGTGCGGTGCCGAGAAGTGTCTGTATCAGAAGGGAGA GCCTGTGCAGTGGTGTTTGACTGCAAGTTCATCGAGACCTCTGCAGCTGTCCAGCACAACGTGAAGGAG CTGTTTGAGGGCATTGTGCGACAGGTGCGCCTTCGGCGGGACAGCAAGGAGAAGAATGAACGGCGGCTG GCCTACCAGAAAAGGAAGGAGAGCATGCCCAGGAAAGCCAGGCGCTTCTGGGGCAAGATCGTGGCCAAA AACAACAAGAATATGGCCTTCAAGCTCAAGTCCAAATCCTGCCATGACCTCTCTGTACTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181702 |
| Insert Size | 891 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181702.2 |
| RefSeq Size | 2080 bp |
| RefSeq ORF | 891 bp |
| Locus ID | 2669 |
| UniProt ID | P55040 |
| Protein Families | Druggable Genome |
| MW | 33.9 kDa |
| Gene Summary | The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Equine Herpesvirus 1 Enters Cells by Two Different Pathways and Infection Requires the Activation of the Cellular Kinase ROCK1
,Arthur R Frampton Jr, Donna B Stolz, Hiroaki Uchida, William F Goins, Justus B Cohen, and Joseph C Glorioso,
J Virol. 2007 Oct;81(20):10879-89.
[GEM]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205286 | GEM (Myc-DDK-tagged)-Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2 |
CNY 2400.00 |
|
| RC205286L3 | Lenti ORF clone of Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC205286L4 | Lenti ORF clone of Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG205286 | GEM (tGFP-tagged) - Human GTP binding protein overexpressed in skeletal muscle (GEM), transcript variant 2 |
CNY 4000.00 |
