ODAPH (NM_178497) Human Untagged Clone

CAT#: SC307196

C4orf26 (untagged)-Human chromosome 4 open reading frame 26 (C4orf26), transcript variant 2



  "NM_178497" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-C4orf26 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AI2A4; C4orf26
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307196 representing NM_178497.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTCGCAGACACTGCTTCTCCTACTGGTTACTGGTATGCTGGTTGGTGGTAACTGTGGCAGAAGGA
CAAGAAGAGGTATTTACGCCTCCTGGAGATTCACAAAATAATGCGGACGCTACCGACTGCCAGATCTTT
ACACTCACCCCTCCACCTGCCCCGAGGAGTCCGGTCACAAGGGCCCAGCCCATCACAAAGACACCCAGG
TGTCCCTTCCATTTTTTTCCACGAAGGCCCAGAATCCATTTTAGGTTTCCAAACAGACCTTTCGTCCCT
TCAAGGTGTAACCACCGTTTTCCATTCCAGCCATTTTATTGGCCACACCGTTACCTTACTTATAGGTAT
TTCCCCAGAAGAAGACTCCAGAGAGGAAGCTCATCTGAGGAAAGCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_178497
Insert Size 393 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178497.3
RefSeq Size 1882 bp
RefSeq ORF 393 bp
Locus ID 152816
UniProt ID Q17RF5
MW 15.6 kDa
Gene Summary Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene is thought to encode an extracellular matrix acidic phosphoprotein that has a function in enamel mineralization during amelogenesis. Mutations in this gene are associated with recessive hypomineralized amelogenesis imperfecta. [provided by RefSeq, Oct 2012]
Transcript Variant: This variant (2) lacks an alternate exon that results in a frameshift in the central and subsequent coding region, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...