MOGAT3 (NM_178176) Human Untagged Clone

CAT#: SC307140

MOGAT3 (untagged)-Human monoacylglycerol O-acyltransferase 3 (MOGAT3)



  "NM_178176" in other vectors (6)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Rabbit polyclonal Anti-DGAT2L7 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DC7; DGAT2L2; MGAT3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_178176 edited
ATGGGAGTTGCCACAACCCTGCAGCCCCCAACCACTTCCAAAACCTTGCAGAAGCAGCAT
CTAGAAGCAGTGGGCGCCTACCAATATGTGCTCACTTTCCTCTTCATGGGCCCTTTCTTC
TCCCTTCTTGTCTTTGTCCTCCTCTTCACGTCACTCTGGCCCTTCTCTGTTTTTTACTTG
GTGTGGCTCTATGTGGACTGGGACACACCCAACCAAGGTGGAAGGCGTTCGGAGTGGATA
AGGAACCGGGCAATTTGGAGACAACTAAGGGATTATTATCCTGTCAAGCTGGTGAAAACA
GCAGAGCTGCCCCCGGATCGGAACTACGTGCTGGGCGCCCACCCTCATGGGATCATGTGT
ACAGGCTTCCTCTGTAATTTCTCCACCGAGAGCAATGGCTTCTCCCAGCTCTTCCCGGGG
CTCCGGCCCTGGTTAGCCGTGCTGGCTGGCCTCTTCTACCTCCCGGTCTATCGCGACTAC
ATCATGTCCTTTGGACTCTGTCCGGTGAGCCGCCAGAGCCTGGACTTCATCCTGTCCCAG
CCCCAGCTCGGGCAGGCCGTGGTCATCATGGTGGGGGGTGCGCACGAGGCCCTGTATTCA
GTCCCCGGGGAGCACTGCCTTACGCTCCAGAAGCGCAAAGGCTTCGTGCGCCTGGCGCTG
AGGCACGGGGCGTCCCTGGTGCCCGTGTACTCCTTTGGGGAGAATGACATCTTTAGACTT
AAGGCTTTTGCCACAGGCTCCTGGCAGCATTGGTGCCAGCTCACCTTCAAGAAGCTCATG
GGCTTCTCTCCTTGCATCTTCTGGGGTCGCGGTCTCTTCTCAGCCACCTCCTGGGGCCTG
CTGCCCTTTGCTGTGCCCATCACCACTGTGGTGGGCCGCCCCATCCCCGTCCCCCAGCGC
CTCCACCCCACCGAGGAGGAAGTCAATCACTATCACGCCCTCTACATGACGGCCCTGGAG
CAGCTCTTCGAGGAGCACAAGGAAAGCTGTGGGGTCCCCGCTTCCACCTGCCTCACCTTC
ATCTAG
Restriction Sites Please inquire     
ACCN NM_178176
Insert Size 1100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178176.2, NP_835470.1
RefSeq Size 1420 bp
RefSeq ORF 1026 bp
Locus ID 346606
UniProt ID Q86VF5
Protein Families Transmembrane
Gene Summary Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerol from 2-monoacylglycerol and fatty acyl-CoA (Cheng et al., 2003 [PubMed 12618427]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...