GPIHBP1 (NM_178172) Human Untagged Clone
CAT＃: SC307137
GPIHBP1 (untagged)-Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GPI-HBP1; HYPL1D |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_178172 edited
CCTTCATCCCACTTACCGCAGCTCCAGAGCCCTGCGGGAGGACTCAGAGTCAGGGACACA GCAGCGTCCGGCGAGATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTGCGGG CGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCA GATGACTACGACGAGGAAGATGAGGATGAGGTTGAAGAGGAGGAGACCAACAGGCTCCCT GGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAG CGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCAC GGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAG CCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTG TGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGC GGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGC CTTGGAGCAATGGGGGCCAGGAGACCCTGACCCACGGCCCCTCCCCACCCCCACCCGGCT CACCCCCGGCCCTGCCAGCACTCTGTCTGGTACCTTCCCCTCCTGCCCCTGCACCAGCTT TGGAGAATGGATTTGGAGTGTCTTGGGCGATCCAGCCAGCGCAGGCCCCCCGGCCCGGTT GCTTCCTCAGTTCCCGGCTGTGTCCTTGGTGTCCTTTCTCCACCACCTGTGAGCAGCAAG ACTGCCGCACGTGGGCGCTGGGTCCAGACCTCGGCTGCCACGCCCCAGGACCTGCAGCCC TCACGGGGGCTGGGGATCCCCATCAGCACAGCCAGGCAGAGATGATACCCACCACACACC TGGGGGCCCCCACACCCAGTCCTCACCCTTAACTTCTGCCATGGGAATTC |
| Restriction Sites | Please inquire |
| ACCN | NM_178172 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_178172.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178172.2, NP_835466.1 |
| RefSeq Size | 2281 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 338328 |
| UniProt ID | Q8IV16 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (1) represents the longer transcript (1) and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207820 | GPIHBP1 (Myc-DDK-tagged)-Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1) |
CNY 2400.00 |
|
| RC207820L1 | Lenti ORF clone of Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC207820L2 | Lenti ORF clone of Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), mGFP tagged |
CNY 5890.00 |
|
| RC207820L3 | Lenti ORF clone of Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), Myc-DDK-tagged |
CNY 4800.00 |
|
| RC207820L4 | Lenti ORF clone of Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), mGFP tagged |
CNY 4800.00 |
|
| RG207820 | GPIHBP1 (tGFP-tagged) - Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1) |
CNY 4000.00 |
其它GPIHBP1产品
