GPIHBP1 (NM_178172) Human Untagged Clone

CAT#: SC307137

GPIHBP1 (untagged)-Human glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1)



  "NM_178172" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-GPIHBP1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPI-HBP1; HYPL1D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_178172 edited
CCTTCATCCCACTTACCGCAGCTCCAGAGCCCTGCGGGAGGACTCAGAGTCAGGGACACA
GCAGCGTCCGGCGAGATGAAGGCGCTCGGGGCTGTCCTGCTTGCCCTCTTGCTGTGCGGG
CGGCCAGGGAGAGGGCAGACACAGCAGGAGGAAGAGGAAGAGGACGAGGACCACGGGCCA
GATGACTACGACGAGGAAGATGAGGATGAGGTTGAAGAGGAGGAGACCAACAGGCTCCCT
GGTGGCAGGAGCAGAGTGCTGCTGCGGTGCTACACCTGCAAGTCCCTGCCCAGGGACGAG
CGCTGCAACCTGACGCAGAACTGCTCACATGGCCAGACCTGCACAACCCTCATTGCCCAC
GGGAACACCGAGTCAGGCCTCCTGACCACCCACTCCACGTGGTGCACAGACAGCTGCCAG
CCCATCACCAAGACGGTGGAGGGGACCCAGGTGACCATGACCTGCTGCCAGTCCAGCCTG
TGCAATGTCCCACCCTGGCAAAGCTCCCGAGTCCAGGACCCAACAGGCAAGGGGGCAGGC
GGCCCCCGGGGCAGCTCCGAAACTGTGGGCGCAGCCCTCCTGCTCAACCTCCTTGCCGGC
CTTGGAGCAATGGGGGCCAGGAGACCCTGACCCACGGCCCCTCCCCACCCCCACCCGGCT
CACCCCCGGCCCTGCCAGCACTCTGTCTGGTACCTTCCCCTCCTGCCCCTGCACCAGCTT
TGGAGAATGGATTTGGAGTGTCTTGGGCGATCCAGCCAGCGCAGGCCCCCCGGCCCGGTT
GCTTCCTCAGTTCCCGGCTGTGTCCTTGGTGTCCTTTCTCCACCACCTGTGAGCAGCAAG
ACTGCCGCACGTGGGCGCTGGGTCCAGACCTCGGCTGCCACGCCCCAGGACCTGCAGCCC
TCACGGGGGCTGGGGATCCCCATCAGCACAGCCAGGCAGAGATGATACCCACCACACACC
TGGGGGCCCCCACACCCAGTCCTCACCCTTAACTTCTGCCATGGGAATTC
Restriction Sites Please inquire     
ACCN NM_178172
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_178172.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178172.2, NP_835466.1
RefSeq Size 2281 bp
RefSeq ORF 555 bp
Locus ID 338328
UniProt ID Q8IV16
Protein Families Druggable Genome
Gene Summary This gene encodes a capillary endothelial cell protein that facilitates the lipolytic processing of triglyceride-rich lipoproteins. The encoded protein is a glycosylphosphatidylinositol-anchored protein that is a member of the lymphocyte antigen 6 (Ly6) family. This protein plays a major role in transporting lipoprotein lipase (LPL) from the subendothelial spaces to the capillary lumen. Mutations in this gene are the cause of hyperlipoproteinemia, type 1D. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (1) represents the longer transcript (1) and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...