LHX3 (NM_178138) Human Untagged Clone
CAT#: SC307130
LHX3 (untagged)-Human LIM homeobox 3 (LHX3), transcript variant 1
CNY 5488.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPHD3; LIM3; M2-LHX3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_178138 edited
CGGGACCCATGGAGGCGCGCGGGATGCTGCTGGAAACGGGGCTCGAGCGCGACCGAGCGA GGCCCGGGGCCGCCGCCGTCTGCACCTTGGGCGGGACTCGGGAGATCCCGCTGTGCGCTG GCTGTGACCAGCACATCCTGGACCGCTTCATCCTCAAGGCTCTGGACCGCCACTGGCACA GCAAGTGTCTCAAGTGCAGCGACTGCCACACGCCACTGGCCGAGCGCTGCTTCAGCCGAG GGGAGAGCGTTTACTGCAAGGACGACTTTTTCAAGCGCTTCGGGACCAAGTGCGCCGCGT GCCAGCTGGGCATCCCGCCCACGCAGGTGGTGCGCCGCGCCCAGGACTTCGTGTACCACC TGCACTGCTTTGCCTGCGTCGTGTGCAAGCGGCAGCTGGCCACGGGCGACGAGTTCTACC TCATGGAGGACAGCCGGCTCGTGTGCAAGGCGGACTACGAAACCGCCAAGCAGCGAGAGG CCGAGGCCACGGCCAAGCGGCCGCGCACGACCATCACCGCCAAGCAGCTGGAGACGCTGA AGAGCGCTTACAACACCTCGCCCAAGCCGGCGCGCCACGTGCGCGAGCAGCTCTCGTCCG AGACGGGCCTGGACATGCGCGTGGTGCAGGTTTGGTTCCAGAACCGCCGGGCCAAGGAGA AGAGGCTGAAGAAGGACGCCGGCCGGCAGCGCTGGGGGCAGTATTTCCGCAACATGAAGC GCTCCCGCGGCGGCTCCAAGTCGGACAAGGACAGCGTTCAGGAGGGGCAGGACAGCGACG CTGAGGTCTCCTTCCCCGATGAGCCTTCCTTGGCGGAAATGGGCCCGGCCAATGGCCTCT ACGGGAGCTTGGGGGAACCCACCCAGGCCTTGGGCCGGCCCTCGGGAGCCCTGGGCAACT TCTCCCTGGAGCATGGAGGCCTGGCAGGCCCAGAGCAGTACCGAGAGCTGCGTCCCGGCA GCCCCTACGGTGTCCCCCCATCCCCCGCCGCCCCGCAGAGCCTCCCTGGCCCCCAGCCCC TCCTCTCCAGCCTGGTGTACCCAGACACCAGCTTGGGCCTTGTGCCCTCGGGAGCCCCCG GCGGGCCCCCACCCATGAGGGTGCTGGCAGGGAACGGACCCAGTTCTGACCTATCCACGG GGAGCAGCGGGGGTTACCCCGACTTCCCTGCCAGCCCCGCCTCCTGGCTGGATGAGGTAG ACCACGCTCAGTTCTGACGCTCGAGTCTCAAGGGCGAATTCAGATCTGGTACCGATATCA AGCTTGTCGAC |
Restriction Sites | Please inquire |
ACCN | NM_178138 |
Insert Size | 1300 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_178138.2, NP_835258.1 |
RefSeq Size | 2184 bp |
RefSeq ORF | 1194 bp |
Locus ID | 8022 |
UniProt ID | Q9UBR4 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the shorter transcript. This transcript encodes two proteins; isoform a and M2-LHX3, which is generated by an internal translation initiation codon. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216247 | LHX3 (Myc-DDK-tagged)-Human LIM homeobox 3 (LHX3), transcript variant 1 |
CNY 5488.00 |
|
RC216247L1 | Lenti ORF clone of Human LIM homeobox 3 (LHX3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216247L2 | Lenti ORF clone of Human LIM homeobox 3 (LHX3), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
RC216247L3 | Lenti ORF clone of Human LIM homeobox 3 (LHX3), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC216247L4 | Lenti ORF clone of Human LIM homeobox 3 (LHX3), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG216247 | LHX3 (tGFP-tagged) - Human LIM homeobox 3 (LHX3), transcript variant 1 |
CNY 4370.00 |