PPP2R4 (PTPA) (NM_178003) Human Untagged Clone
CAT＃: SC307119
PPP2R4 (untagged)-Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5
CNY 6270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PP2A; PPP2R4; PR53 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307119 representing NM_178003.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGAGGGCGAGCGGCAGCCGCCGCCAGATTCTTCAGAGGAGGCCCCTCCAGCCACTCAGAACTTC ATCATTCCAAAAAAGGAGATCCACACAGTTCCAGACATGGGCAAATGGAAGCGTTCTCAGGCATACGCT GACTACATCGGATTCATCCTTACCCTCAACGAAGGTGTGAAGGGGAAGAAGCTGACCTTCGAGTACAGA GTCTCCGAGGAAGCAGAAAACTTGGTGGCCACAGTGGTCCCTACCCATCTGGCAGCTGCTGTGCCTGAG GTGGCTGTTTACCTAAAGGAGTCAGTGGGGAACTCCACGCGCATTGACTACGGCACAGGGCATGAGGCA GCCTTCGCTGCTTTCCTCTGCTGTCTCTGCAAGATTGGGGTGCTCCGGGTGGATGACCAAATAGCTATT GTCTTCAAGGTGTTCAATCGGTACCTTGAGGTTATGCGGAAACTCCAGAAAACATACAGGATGGAGCCA GCCGGCAGCCAGGGAGTGTGGGGTCTGGATGACTTCCAGTTTCTGCCCTTCATCTGGGGCAGTTCGCAG CTGATAGACCACCCATACCTGGAGCCCAGACACTTTGTGGATGAGAAGGCCGTGAATGAGAACCACAAG GACTACATGTTCCTGGAGTGTATCCTGTTTATTACCGAGATGAAGACTGGCCCATTTGCAGAGCACTCC AACCAGCTGTGGAACATCAGCGCCGTCCCTTCCTGGTCCAAAGTGAACCAGGGTCTCATCCGCATGTAT AAGGCCGAGTGCCTGGAGAAGTTCCCTGTGATCCAGCACTTCAAGTTCGGGAGCCTGCTGCCCATCCAT CCTGTCACGTCGGGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_178003 |
| Insert Size | 846 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_178003.2 |
| RefSeq Size | 2638 bp |
| RefSeq ORF | 846 bp |
| Locus ID | 5524 |
| UniProt ID | Q15257 |
| Protein Families | Druggable Genome, Phosphatase |
| MW | 31.9 kDa |
| Gene Summary | Protein phosphatase 2A is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2A holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B' family. This gene encodes a specific phosphotyrosyl phosphatase activator of the dimeric form of protein phosphatase 2A. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (5) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter protein (isoform d), also known as isoform epsilon, that is missing an internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214397 | PPP2R4 (Myc-DDK-tagged)-Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5 |
CNY 2400.00 |
|
| RC214397L3 | Lenti ORF clone of Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC214397L4 | Lenti ORF clone of Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
| RG214397 | PPP2R4 (tGFP-tagged) - Human protein phosphatase 2A activator, regulatory subunit 4 (PPP2R4), transcript variant 5 |
CNY 4370.00 |
