RASSF6 (NM_177532) Human Untagged Clone

CAT#: SC307102

RASSF6 (untagged)-Human Ras association (RalGDS/AF-6) domain family member 6 (RASSF6), transcript variant 1



  "NM_177532" in other vectors (4)

CNY 5510.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-RASSF6 antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307102 representing NM_177532.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACTATGATGGCTCACCAGTACCCCTCTTGGATCTTCATTAATGAGAAGACATTCATAACCAGGGAA
CAACTTAATTCTTTATTGAAGACCTATAACATTTTTTATGAGAACCAGAAAAATCTGCATATTTTATAT
GGAGAGACTGAAGATGGCAAACTAATTGTTGAAGGAATGCTGGACATTTTCTGGGGAGTAAAACGACCT
ATACAGCTAAAAATACAAGATGAGAAGCCATTCTCTTCTTTTACTAGTATGAAGTCATCAGACGTCTTC
TCCAGCAAAGGAATGACACGCTGGGGGGAATTTGACGATCTCTATCGTATTAGTGAGCTGGACAGGACC
CAGATTCCTATGTCTGAAAAAAGGAATTCCCAGGAAGACTATTTATCTTATCACAGCAACACCCTGAAG
CCACATGCAAAGGATGAACCAGACTCCCCAGTGCTCTATAGAACCATGAGTGAAGCAGCTCTGGTGAGA
AAAAGGATGAAGCCTCTGATGATGGACAGAAAAGAAAGACAGAAAAATAGAGCCTCTATTAATGGACAC
TTCTATAACCATGAAACATCAATTTTCATTCCAGCCTTTGAATCAGAAACTAAGGTCAGAGTAAACAGT
AACATGAGAACTGAAGAAGTAATAAAGCAACTTCTCCAAAAATTTAAGATTGAAAATAGTCCCCAGGAT
TTTGCTCTTCACATTATTTTTGCAACAGGAGAACAAAGACGACTAAAGAAGACAGACATTCCGCTACTG
CAGAGGCTCCTACAGGGACCTTCTGAAAAGAATGCTCGCATTTTCCTCATGGATAAAGATGCAGAAGAA
ATTAGCAGTGATGTGGCTCAGTACATTAACTTTCACTTTTCTCTCTTGGAATCCATTCTTCAAAGATTA
AATGAAGAAGAGAAAAGAGAGATTCAAAGAATAGTAACAAAATTCAATAAAGAAAAGGCGATTATACTG
AAATGTCTTCAAAATAAACTAGTAATAAAAACAGAGACAACAGTTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_177532
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_177532.4
RefSeq Size 6040 bp
RefSeq ORF 1014 bp
Locus ID 166824
UniProt ID Q6ZTQ3
MW 39.8 kDa
Gene Summary This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) represents the longest transcript. It encodes isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...