LYNX1 (NM_177476) Human Untagged Clone
CAT＃: SC307099
LYNX1 (untagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_177476, the custom clone sequence may differ by one or more nucleotides
ATGACGCCCCTGCTCACCCTGATCCTGGTGGTCCTCATGGGCTTACCTCTGGCCCAGGCC TTGGACTGCCACGTGTGTGCCTACAACGGAGACAACTGCTTCAACCCCATGCGCTGCCCG GCTATGGTTGCCTACTGCATGACCACGCGCACCTACTACACCCCCACCAGGATGAAGGTC AGTAAGTCCTGCGTGCCCCGCTGCTTCGAGACTGTGTATGATGGCTACTCCAAGCACGCG TCCACCACCTCCTGCTGCCAGTACGACCTCTGCAACGGCACCGGCCTTGCCACCCCGGCC ACCCTGGCCCTGGCCCCCATCCTCCTGGCCACCCTCTGGGGTCTCCTCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_177476 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_177476.1, NP_803429.1 |
| RefSeq Size | 663 bp |
| RefSeq ORF | 351 bp |
| Locus ID | 66004 |
| UniProt ID | P0DP58 |
| Protein Families | Druggable Genome |
| Gene Summary | This gene encodes a GPI-anchored, cell membrane bound member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This protein interacts with nicotinic acetylcholine receptors (nAChRs), and is thought to function as a modulator of nAChR activity to prevent excessive excitation. Alternatively spliced transcript variants have been found for this gene. Read-through transcription between this gene and the neighboring downstream gene (SLURP2) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017] Transcript Variant: This variant (2) contains an alternate 5' terminal exon compared to variant 1. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213493 | LYNX1 (Myc-DDK-tagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 1200.00 |
|
| RC213493L1 | Lenti-ORF clone of LYNX1 (Myc-DDK-tagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 3600.00 |
|
| RC213493L2 | Lenti-ORF clone of LYNX1 (mGFP-tagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 5890.00 |
|
| RC213493L3 | Lenti-ORF clone of LYNX1 (Myc-DDK-tagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 5890.00 |
|
| RC213493L4 | Lenti-ORF clone of LYNX1 (mGFP-tagged)-Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 5890.00 |
|
| RG213493 | LYNX1 (tGFP-tagged) - Human Ly6/neurotoxin 1 (LYNX1), transcript variant 4 |
CNY 4370.00 |
