TAS2R41 (NM_176883) Human Untagged Clone
CAT#: SC307079
TAS2R41 (untagged)-Human taste receptor, type 2, member 41 (TAS2R41)
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | T2R41; T2R59 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_176883 edited
ATGCAAGCAGCACTGACGGCCTTCTTCGTGTTGCTCTTTAGCCTGCTGAGTCTTCTGGGG ATTGCAGCGAATGGCTTCATTGTGCTGGTGCTGGGCAGGGAGTGGCTGCGATATGGCAGG TTGCTGCCCTTGGATATGATCCTCATTAGCTTGGGTGCCTCCCGCTTCTGCCTGCAGTTG GTTGGGACGGTGCACAACTTCTACTACTCTGCCCAGAAGGTCGAGTACTCTGGGGGTCTC GGCCGACAGTTCTTCCATCTACACTGGCACTTCCTGAACTCAGCCACCTTCTGGTTTTGC AGCTGGCTCAGTGTCCTGTTCTGTGTGAAGATTGCTAACATCACACACTCCACCTTCCTG TGGCTGAAGTGGAGGTTCCCAGGGTGGGTGCCCTGGCTCCTGTTGGGCTCTGTCCTGATC TCCTTCATCATAACCCTGCTGTTTTTTTGGGTGAACTACCCTGTATATCAAGAATTTTTA ATTAGAAAATTTTCTGGGAACATGACCTACAAGTGGAATACAAGGATAGAAACATACTAT TTCCCATCCCTGAAACTGGTCATCTGGTCAATTCCTTTTTCTGTTTTTCTGGTCTCAATT ATGCTGTTAATTAATTCTCTGAGGAGGCATACTCAGAGAATGCAGCACAACGGGCACAGC CTGCAGGACCCCAGCACCCAGGCTCACACCAGAGCTCTGAAGTCCCTCATCTCCTTCCTC ATTCTTTATGCTCTGTCCTTTCTGTCCCTGATCATTGATGCCGCAAAATTTATCTCCATG CAGAACGACTTTTACTGGCCATGGCAAATTGCAGTCTACCTGTGCATATCTGTCCATCCC TTCATCCTCATCTTCAGCAACCTCAAGCTTCGAAGCGTGTTCTCGCAGCTCCTGTTGTTG GCAAGGGGCTTCTGGGTGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_176883 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_176883.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_176883.1, NP_795364.1 |
RefSeq Size | 924 bp |
RefSeq ORF | 924 bp |
Locus ID | 259287 |
UniProt ID | P59536 |
Protein Pathways | Taste transduction |
Gene Summary | This gene encodes a member of the bitter taste receptor family which belong to the G protein-coupled receptor superfamily and are predominantly expressed in taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a seven-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered together with eight other taste receptor genes on chromosome 7. Chloramphenicol is an agonist for the encoded protein. [provided by RefSeq, Jul 2017] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213067 | TAS2R41 (Myc-DDK-tagged)-Human taste receptor, type 2, member 41 (TAS2R41) |
CNY 2400.00 |
|
RC213067L3 | Lenti ORF clone of Human taste receptor, type 2, member 41 (TAS2R41), Myc-DDK-tagged |
CNY 5890.00 |
|
RC213067L4 | Lenti ORF clone of Human taste receptor, type 2, member 41 (TAS2R41), mGFP tagged |
CNY 5890.00 |
|
RG213067 | TAS2R41 (tGFP-tagged) - Human taste receptor, type 2, member 41 (TAS2R41) |
CNY 4370.00 |
其它TAS2R41产品