MCEMP1 (NM_174918) Human Untagged Clone
CAT＃: SC306955
C19orf59 (untagged)-Human chromosome 19 open reading frame 59 (C19orf59)
CNY 3656.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C19orf59 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_174918 edited
ATGGAAGTGGAGGAAATCTACAAGCACCAGGAAGTCAAGATGCAAGCACCAGCCTTCAGG GACAAGAAACAGGGGGTCTCAGCCAAGAATCAAGGTGCCCATGACCCAGACTATGAGAAT ATCACCTTGGCCTTCAAAAATCAGGACCATGCAAAGGGTGGTCATTCACGACCCACGAGC CAAGTCCCAGCCCAGTGCAGGCCGCCCTCAGACTCCACCCAGGTCCCCTGCTGGTTGTAC AGAGCCATCCTGAGCCTGTACATCCTCCTGGCCCTGGCCTTTGTCCTCTGCATCATCCTG TCAGCCTTCATCATGGTGAAGAATGCTGAGATGTCCAAGGAGCTGCTGGGCTTTAAAAGG GAGCTTTGGAATGTCTCAAACTCCGTACAAGCATGCGAAGAGAGACAGAAGAGAGGCTGG GATTCCGTTCAGCAGAGCATCACCATGGTCAGGAGCAAGATTGATAGATTAGAGACGACA TTAGCAGGCATAAAAAACATTGACACAAAGGTACAGAAAATCTTGGAGGTGCTGCAGAAA ATGCCACAGTCCTCACCTCAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_174918 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_174918.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_174918.1, NP_777578.1 |
| RefSeq Size | 1750 bp |
| RefSeq ORF | 1326 bp |
| Locus ID | 199675 |
| UniProt ID | Q8IX19 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a single-pass transmembrane protein. Based on its expression pattern, it is speculated to be involved in regulating mast cell differentiation or immune responses. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211156 | C19orf59 (Myc-DDK-tagged)-Human chromosome 19 open reading frame 59 (C19orf59) |
CNY 2400.00 |
|
| RC211156L3 | Lenti ORF clone of Human chromosome 19 open reading frame 59 (C19orf59), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211156L4 | Lenti ORF clone of Human chromosome 19 open reading frame 59 (C19orf59), mGFP tagged |
CNY 4800.00 |
|
| RG211156 | C19orf59 (tGFP-tagged) - Human chromosome 19 open reading frame 59 (C19orf59) |
CNY 4000.00 |
