DAOA (NM_172370) Human Untagged Clone

CAT#: SC306764

DAOA (untagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 1



  "NM_172370" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DAOA rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LG72; SG72
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_172370 edited
ATGCTGGAAAAGCTGATGGGTGCTGATTCTCTCCAGCTTTTCAGATCCAGATATACATTG
GGTAAAATCTACTTCATAGGTTTTCAAAAGAGCATTCTTCTGAGCAAATCTGAAAACTCT
CTAAACTCTATTGCAAAGGAGACAGAAGAAGGAAGAGAGACGGTAACAAGGAAAGAAGGA
TGGAAGAGAAGGCATGAGGACGGCTATTTGGAAATGGCACAGAGGCATTTACAGAGATCA
TTATGTCCTTGGGTCTCTTACCTTCCTCAGCCCTATGCAGAGCTTGAAGAAGTAAGCAGC
CATGTTGGAAAAGTCTTCATGGCAAGAAACTATGAGTTCCTTGCCTATGAGGCCTCTAAG
GACCGCAGGCAGCCTCTAGAACGAATGTGGACCTGCAACTACAACCAGCAAAAAGACCAG
TCATGCAACCACAAGGAAATAACTTCTACCAAAGCTGAATGACTCGA
Restriction Sites Please inquire     
ACCN NM_172370
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172370.2, NP_758958.2
RefSeq Size 742 bp
RefSeq ORF 462 bp
Locus ID 267012
UniProt ID P59103
Protein Families Druggable Genome
Gene Summary This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Mar 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1). CCDS Note: This CCDS ID represents the protein described in PMIDs: 12364586 and 14966479. This transcript is supported by AY138546.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 18544534. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...