DAOA (NM_172370) Human Untagged Clone
CAT#: SC306764
DAOA (untagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 1
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LG72; SG72 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_172370 edited
ATGCTGGAAAAGCTGATGGGTGCTGATTCTCTCCAGCTTTTCAGATCCAGATATACATTG GGTAAAATCTACTTCATAGGTTTTCAAAAGAGCATTCTTCTGAGCAAATCTGAAAACTCT CTAAACTCTATTGCAAAGGAGACAGAAGAAGGAAGAGAGACGGTAACAAGGAAAGAAGGA TGGAAGAGAAGGCATGAGGACGGCTATTTGGAAATGGCACAGAGGCATTTACAGAGATCA TTATGTCCTTGGGTCTCTTACCTTCCTCAGCCCTATGCAGAGCTTGAAGAAGTAAGCAGC CATGTTGGAAAAGTCTTCATGGCAAGAAACTATGAGTTCCTTGCCTATGAGGCCTCTAAG GACCGCAGGCAGCCTCTAGAACGAATGTGGACCTGCAACTACAACCAGCAAAAAGACCAG TCATGCAACCACAAGGAAATAACTTCTACCAAAGCTGAATGACTCGA |
Restriction Sites | Please inquire |
ACCN | NM_172370 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_172370.2, NP_758958.2 |
RefSeq Size | 742 bp |
RefSeq ORF | 462 bp |
Locus ID | 267012 |
UniProt ID | P59103 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Mar 2011] Transcript Variant: This variant (1) encodes the longest isoform (1). CCDS Note: This CCDS ID represents the protein described in PMIDs: 12364586 and 14966479. This transcript is supported by AY138546.1. It should be noted this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID: 18544534. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212162 | DAOA (Myc-DDK-tagged)-Human D-amino acid oxidase activator (DAOA), transcript variant 1 |
CNY 1200.00 |
|
RC212162L1 | Lenti ORF clone of Human D-amino acid oxidase activator (DAOA), transcript variant 1, Myc-DDK-tagged |
CNY 3600.00 |
|
RC212162L2 | Lenti ORF clone of Human D-amino acid oxidase activator (DAOA), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC212162L3 | Lenti ORF clone of Human D-amino acid oxidase activator (DAOA), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC212162L4 | Lenti ORF clone of Human D-amino acid oxidase activator (DAOA), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG212162 | DAOA (tGFP-tagged) - Human D-amino acid oxidase activator (DAOA), transcript variant 1 |
CNY 4370.00 |