CD200R (CD200R1) (NM_170780) Human Untagged Clone
CAT#: SC306699
CD200R1 (untagged)-Human CD200 receptor 1 (CD200R1), transcript variant 4
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD200R; HCRTR2; MOX2R; OX2R |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_170780 edited
TCTCACCATGCGCACAGTTCCTTCTGTACCTGTGTGGAGGAAAAGTACTGAGTGAAGGGC AGAAAAAGAGAAAACAGAAATGCTCTGCCCTTGGAGAACTGCTAACCTAGGGCTACTGTT GATTTTGACTATCTTCTTAGTGGCCGCTTCAAGCAGTTTATGTATGGATGAAAAACAGAT TACACAGAACTACTCGAAAGTACTCGCAGAAGTTAACACTTCATGGCCTGTAAAGATGGC TACAAATGCTGTGCTTTGTTGCCCTCCTATCGCATTAAGAAATTTGATCATAATAACATG GGAAATAATCCTGAGAGGCCAGCCTTCCTGCACAAAAGCCTACAAGAAAGAAACAAATGA GACCAAGGAAACCAACTGTACTGATGAGAGAATAACCTGGGTCTCCAGACCTGATCAGAA TTCGGACCTTCAGATTCGTACCGTGGCCATCACTCATGACGGGTATTACAGATGCATAAT GGTAACACCTGATGGGAATTTCCATCGTGGATATCACCTCCAAGTGTTAGTTACACCTGA AGTGACCCTGTTTCAAAACAGGAATAGAACTGCAGTATGCAAGGCAGTTGCAGGGAAGCC AGCTGCGCATATCTCCTGGATCCCAGAGGGCGATTGTGCCACTAAGCAAGAATACTGGAG CAATGGCACAGTGACTGTTAAGAGTACATGCCACTGGGAGGTCCACAATGTGTCTACCGT GACCTGCCACGTCTCCCATTTGACTGGCAACAAGAGTCTGTACATAGAGCTACTTCCTGT TCCAGGTGCCAAAAAATCAGCAAAATTATATATTCCATATATCATCCTTACTATTATTAT TTTGACCATCGTGGGATTCATTTGGTTGTTGAAAGTCAATGGCTGCAGAAAATATAAATT GAATAAAACAGAATCTACTCCAGTTGTTGAGGAGGATGAAATGCAGCCCTATGCCAGCTA CACAGAGAAGAACAATCCTCTCTATGATACTACAAACAAGGTGAAGGCATCTGAGGCATT ACAAAGTGAAGTTGACACAGACCTCCATACTTTATAAGTTGTTGGACTCTAGTACCAAGA AACAACAACAAACGAGA |
Restriction Sites | Please inquire |
ACCN | NM_170780 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_170780.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_170780.2, NP_740750.1 |
RefSeq Size | 2203 bp |
RefSeq ORF | 978 bp |
Locus ID | 131450 |
UniProt ID | Q8TD46 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a receptor for the OX-2 membrane glycoprotein. Both the receptor and substrate are cell surface glycoproteins containing two immunoglobulin-like domains. This receptor is restricted to the surfaces of myeloid lineage cells and the receptor-substrate interaction may function as a myeloid downregulatory signal. Mouse studies of a related gene suggest that this interaction may control myeloid function in a tissue-specific manner. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) utilizes an alternate splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform d), compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210870 | CD200R1 (Myc-DDK-tagged)-Human CD200 receptor 1 (CD200R1), transcript variant 4 |
CNY 2400.00 |
|
RC210870L3 | Lenti ORF clone of Human CD200 receptor 1 (CD200R1), transcript variant 4, Myc-DDK-tagged |
CNY 4800.00 |
|
RC210870L4 | Lenti ORF clone of Human CD200 receptor 1 (CD200R1), transcript variant 4, mGFP tagged |
CNY 5890.00 |
|
RG210870 | CD200R1 (tGFP-tagged) - Human CD200 receptor 1 (CD200R1), transcript variant 4 |
CNY 4000.00 |