United States
Germany
Japan
United Kingdom
China
MLX (NM_170607) Human Untagged Clone
CAT＃: SC306675
MLX (untagged)-Human MAX-like protein X (MLX), transcript variant 3
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | bHLHd13; MAD7; MXD7; TCFL4; TF4 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_170607 edited
CCGGTGGGTACAAGATGACGGAGCCGGGCGCCTCTCCCGAGGACCCTTGGGTCAAGGCAA GCCCCGTGGGCGCGCACGCCGGCGAGGGGAGGGCGGGTCGGGCTCGTGCACGTAGGGGGG CCGGAAGACGAGGGGCTTCCCTCCTGTCCCCAAAGTCCCCCACGCTCTCCGTGCCCCGGG GCTGCAGAGAAGACAGCTCTCACCCCGCGTGTGCCAAGGTGGAGTATGCCTACAGCGACA ACAGCCTGGACCCCGGGCTTTTTGTAGAAAGCACCCGCAAGGGGAGTGTAGTGTCCAGAG CTAATAGCATCGGTTCCACCAGTGCCTCTTCTGTCCCCAACACAGATGATGAGGACAGTG ATTACCACCAGGAGGCCTACAAGGAGTCCTACAAAGACCGGCGGCGGCGCGCACACACTC AGGCTGAGCAGAAGAGGAGGGACGCCATCAAGAGAGGCTATGATGACCTTCAGACCATCG TCCCCACTTGCCAGCAGCAGGACTTCTCCATTGGCTCCCAAAAGCTCAGCAAAGCCATCG TTCTACAAAAGACCATTGACTACATTCAGTTTTTGCACAAGGAGAAGAAAAAGCAGGAGG AGGAGGTGTCCACGTTACGCAAGGATGTCACCGCCCTAAAGATCATGAAAGTGAACTATG AGCAGATTGTGAAGGCACACCAGGACAACCCCCATGAAGGGGAGGACCAGGTCTCTGACC AGGTCAAGTTCAACGTGTTTCAAGGCATCATGGATTCCCTGTTCCAGTCCTTCAATGCCT CCATCTCAGTGGCCAGCTTCCAGGAGCTGTCAGCATGTGTCTTCAGCTGGATCGAGGAGC ACTGTAAGCCTCAGACCCTGCGGGAGATTGTGATTGGCGTCCTGCACCAATTGAAAAACC AGCTTTACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_170607 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found the protein coded by this clone is identical to NM_170607.2. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_170607.2, NP_733752.1 |
| RefSeq Size | 2568 bp |
| RefSeq ORF | 897 bp |
| Locus ID | 6945 |
| UniProt ID | Q9UH92 |
| Protein Families | Druggable Genome, Transcription Factors |
| Gene Summary | The product of this gene belongs to the family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors. These factors form heterodimers with Mad proteins and play a role in proliferation, determination and differentiation. This gene product may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors, namely, Mad1 and Mad4. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) contains two additional segments in the coding region compared to variant 1. The resulting isoform (gamma) thus, is longer than isoform alpha encoded by variant 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224283 | MLX (Myc-DDK-tagged)-Human MAX-like protein X (MLX), transcript variant 3 |
CNY 2,400.00 |
|
| RC224283L1 | Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC224283L2 | Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC224283L3 | Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224283L4 | Lenti ORF clone of Human MAX-like protein X (MLX), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG224283 | MLX (tGFP-tagged) - Human MAX-like protein X (MLX), transcript variant 3 |
CNY 4,370.00 |
