IL19 (NM_153758) Human Untagged Clone
CAT＃: SC306657
IL19 (untagged)-Human interleukin 19 (IL19), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | IL-10C; MDA1; NG.1; ZMDA1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_153758, the custom clone sequence may differ by one or more nucleotides
ATGTGCACTGAGGGAGCGTTTCCGCACAGATCTGCGTGTTCCTTACCACTCACACATGTG CACACACATATCCATGTGTGTGTGCCAGTGCTTTGGGGCTCTGTTCCACGGGGCATGAAG TTACAGTGTGTTTCCCTTTGGCTCCTGGGTACAATACTGATATTGTGCTCAGTAGACAAC CACGGTCTCAGGAGATGTCTGATTTCCACAGACATGCACCATATAGAAGAGAGTTTCCAA GAAATCAAAAGAGCCATCCAAGCTAAGGACACCTTCCCAAATGTCACTATCCTGTCCACA TTGGAGACTCTGCAGATCATTAAGCCCTTAGATGTGTGCTGCGTGACCAAGAACCTCCTG GCGTTCTACGTGGACAGGGTGTTCAAGGATCATCAGGAGCCAAACCCCAAAATCTTGAGA AAAATCAGCAGCATTGCCAACTCTTTCCTCTACATGCAGAAAACTCTGCGGCAATGTCAG GAACAGAGGCAGTGTCACTGCAGGCAGGAAGCCACCAATGCCACCAGAGTCATCCATGAC AACTATGATCAGCTGGAGGTCCACGCTGCTGCCATTAAATCCCTGGGAGAGCTCGACGTC TTTCTAGCCTGGATTAATAAGAATCATGAAGTAATGTTCTCAGCTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_153758 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_153758.1, NP_715639.1 |
| RefSeq Size | 1030 bp |
| RefSeq ORF | 648 bp |
| Locus ID | 29949 |
| UniProt ID | Q9UHD0 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
| Gene Summary | The protein encoded by this gene is a cytokine that belongs to the IL10 cytokine subfamily. This cytokine is found to be preferentially expressed in monocytes. It can bind the IL20 receptor complex and lead to the activation of the signal transducer and activator of transcription 3 (STAT3). A similar cytokine in mouse is reported to up-regulate the expression of IL6 and TNF-alpha and induce apoptosis, which suggests a role of this cytokine in inflammatory responses. Alternatively spliced transcript variants encoding the distinct isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212393 | IL19 (Myc-DDK-tagged)-Human interleukin 19 (IL19), transcript variant 1 |
CNY 3990.00 |
|
| RC212393L3 | Lenti-ORF clone of IL19 (Myc-DDK-tagged)-Human interleukin 19 (IL19), transcript variant 1 |
CNY 5890.00 |
|
| RC212393L4 | Lenti-ORF clone of IL19 (mGFP-tagged)-Human interleukin 19 (IL19), transcript variant 1 |
CNY 5890.00 |
|
| RG212393 | IL19 (tGFP-tagged) - Human interleukin 19 (IL19), transcript variant 1 |
CNY 4370.00 |
