HOXA1 (NM_153620) Human Untagged Clone

CAT#: SC306628

HOXA1 (untagged)-Human homeobox A1 (HOXA1), transcript variant 2



  "NM_153620" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HOXA1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BSAS; HOX1; HOX1F
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306628 representing NM_153620.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAATGCAAGAATGAACTCCTTCCTGGAATACCCCATACTTAGCAGTGGCGACTCGGGGACCTGC
TCAGCCCGAGCCTACCCCTCGGACCATAGGATTACAACTTTCCAGTCGTGCGCGGTCAGCGCCAACAGT
TGCGGCGGCGACGACCGCTTCCTAGTGGGCAGGGGGGTGCAGATCGGTTCGCCCCACCACCACCACCAC
CACCACCATCACCACCCCCAGCCGGCTACCTACCAGACTTCCGGGAACCTGGGGGTGTCCTACTCCCAC
TCAAGTTGTGGTCCAAGCTATGGCTCACAGAACTTCAGTGCGCCTTACAGCCCCTACGCGTTAAATCAG
GAAGCAGACCCACCAAGAAGCCTGTCGCTCCCCCGCATCGGAGACATCTTCTCCAGCGCAGACTTTTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_153620
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_153620.2
RefSeq Size 2358 bp
RefSeq ORF 414 bp
Locus ID 3198
UniProt ID P49639
Protein Families Druggable Genome, Transcription Factors
MW 14.8 kDa
Gene Summary In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. The encoded protein may be involved in the placement of hindbrain segments in the proper location along the anterior-posterior axis during development. Two transcript variants encoding two different isoforms have been found for this gene, with only one of the isoforms containing the homeodomain region. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate coding segment compared to variant 1, which causes a frameshift. The resulting isoform (b) has a shorter, distinct C-terminus and lacks the homeodomain region compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...