TAB1 (NM_153497) Human Untagged Clone

CAT#: SC306622

TAB1 (untagged)-Human TGF-beta activated kinase 1/MAP3K7 binding protein 1 (TAB1), transcript variant beta



  "NM_153497" in other vectors (4)

CNY 3656.00

CNY 7320.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TAB1 Antibody
    • 100 ul

CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 3'-Tab1; MAP3K7IP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC306622 representing NM_153497.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGACAGATGACCTGCCTCTC
TGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACTCTGCTGATGGCAAGGGCACTGAGAGC
CACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGAGTGAGAACAACTGCTTCCTGTATGGGGTCTTCAAC
GGCTATGATGGCAACCGAGTGACCAACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAG
CTGAATGCCGAGCACGCCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGG
AGCTTCCTGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGGGA
GTCCCTCAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGTTAGAGAGGGAA
ATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGCTCTACGTCGCCAATGTCGGT
ACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGTTGCAGGTGACACAGCTGAACGTGGACCAC
ACCACAGAGAACGAGGATGAGCTCTTCCGTCTTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAGCAG
GTGGGGATCATCTGTGGGCAGGAGAGCACCCGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACG
GACATTGACCTTCTCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAG
CCGCTGGATGGGGTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGGCAGCC
CATGGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTGCCAAGCAGACCTCC
CTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCCACAGCGACACCTTCGCCAGTGGT
GGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACATGACCCTGCTAGTGAGGAACTTTGGCTACCCG
CTGGGCGAAATGAGCCAGCCCACACCGAGCCCAGCCCCAGCTGCAGGAGGACGAGTGTACCCTGTGTCT
GTGCCATACTCCAGCGCCCAGAGCACCAGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAG
GGCCAGATGGTCAACGGGGCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAAAGAC
CCTTCCAGGCCTGCAAGCGATTTGACAGCCATCCCTCAGTGCCAACTAAACCTCCTGGGCAGCCTGACC
CCAGGGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_153497
Insert Size 1389 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_153497.2
RefSeq Size 1994 bp
RefSeq ORF 1389 bp
Locus ID 10454
UniProt ID Q15750
Protein Families Druggable Genome
Protein Pathways MAPK signaling pathway, NOD-like receptor signaling pathway, Toll-like receptor signaling pathway
MW 49.9 kDa
Gene Summary The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (beta) uses an alternate exon at the 3' end compared to variant 1, which includes a part of the coding region. The resulting isoform (beta) has a distinct and shorter C-terminus, as compared to isoform alpha. The beta isoform can interact with and activate MAPK14/p38alpha, but it does not bind or activate MAP3K7/TAK1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...