TIRAP (NM_148910) Human Untagged Clone

CAT#: SC306331

TIRAP (untagged)-Human toll-interleukin 1 receptor (TIR) domain containing adaptor protein (TIRAP), transcript variant 2



  "NM_148910" in other vectors (4)

CNY 3990.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal TIRAP Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BACTS1; Mal; MyD88-2; wyatt
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_148910 edited
ATGGCATCATCGACCTCCCTCCCAGCTCCTGGCTCTCGGCCTAAGAAGCCTCTAGGCAAG
ATGGCTGACTGGTTCAGGCAGACCCTGCTGAAGAAGCCCAAGAAGAGGCCCAACTCCCCA
GAAAGCACCTCCAGCGATGCTTCACAGCCTACCTCACAGGACAGCCCACTACCCCCAAGC
CTCAGCTCAGTCACGTCTCCCAGCCTGCCACCCACACATGCGAGTGACAGTGGCAGTAGT
CGCTGGAGCAAAGACTATGACGTCTGCGTGTGCCACAGTGAGGAAGACCTGGTGGCCGCC
CAGGACCTGGTCTCCTACTTGGAAGGCAGCACTGCCAGCCTGCGCTGCTTCCTGCAACTC
CGGGATGCAACCCCAGGCGGCGCTATAGTGTCCGAGCTGTGCCAGGCACTGAGCAGTAGT
CACTGCCGGGTGCTGCTCATCACGCCGGGCTTCCTTCAGGACCCCTGGTGCAAGTACCAG
ATGCTGCAGGCCCTGACCGAGGCTCCAGGGGCCGAGGGCTGCACCATCCCCCTGCTGTCG
GGCCTCAGCAGAGCTGCCTACCCACCTGAGCTCCGATTCATGTACTACGTCGATGGCAGG
GGCCCTGATGGTGGCTTTCGTCAAGTCAAAGAAGCTGTCATGCGTTGTAAGCTACTACAG
GAGGGAGAAGGGGAACGGGATTCAGCTACAGTATCTGATCTACTTTGA
Restriction Sites Please inquire     
ACCN NM_148910
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_148910.1, NP_683708.1
RefSeq Size 1199 bp
RefSeq ORF 708 bp
Locus ID 114609
UniProt ID P58753
Protein Families Druggable Genome
Protein Pathways Toll-like receptor signaling pathway
Gene Summary The innate immune system recognizes microbial pathogens through Toll-like receptors (TLRs), which identify pathogen-associated molecular patterns. Different TLRs recognize different pathogen-associated molecular patterns and all TLRs have a Toll-interleukin 1 receptor (TIR) domain, which is responsible for signal transduction. The protein encoded by this gene is a TIR adaptor protein involved in the TLR4 signaling pathway of the immune system. It activates NF-kappa-B, MAPK1, MAPK3 and JNK, which then results in cytokine secretion and the inflammatory response. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an additional segment within the 5' UTR and differs in the 3' coding region and 3' UTR, compared to variant 3. This results in a longer isoform (b) with a distinct C-terminus, compared to isoform a. Variants 2 and 4 both encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...