TGIF2LY (NM_139214) Human Untagged Clone
CAT＃: SC306133
TGIF2LY (untagged)-Human TGFB-induced factor homeobox 2-like, Y-linked (TGIF2LY)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TGIFLY |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306133 representing NM_139214.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGCCGCTGCAGACGGCCCGGCTGAGACCCAAAGCCCGGTGGAAAAAGACAGCCCGGCGAAGACC CAAAGCCCAGCCCAAGACACCTCAATCATGTCGAGAAATAACGCAGATACAGGCAGAGTTCTTGCCTTA CCAGAGCACAAGAAGAAGCGCAAGGGAAACTTGCCAGCCGAGTCCGTTAAGATCCTCCGCGACTGGATG TATAAGCATCGGTTTAAGGCCTACCCTTCAGAAGAAGAGAAGCAAATGCTGTCAGAGAAGACCAATTTG TCTTTGTTGCGGATTTCTAACTGGTTTATCAATGCTCGCAGACGCATTCTCCCGGATATGCTTCAACAG CGTAGAAACGACCCCATCATTGGCCACAAAACGGGCAAAGATGCCCATGCCACCCACCTGCAGAGCACC GAGGCGTCTGTGCCGGCCAAGTCAGGGCCAGTGGTCCAGACAATGTACAAAGCCTGCCCCTGTGGCCCT TGCCAAAGGGCCAGATGTCAAGAGAGAAGCAACCAGATCCGGAGTCGGCCCCTAGCCAGAAGCTCACCG GAATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_139214 |
| Insert Size | 558 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_139214.2 |
| RefSeq Size | 880 bp |
| RefSeq ORF | 558 bp |
| Locus ID | 90655 |
| UniProt ID | Q8IUE0 |
| Protein Families | Transcription Factors |
| MW | 20.8 kDa |
| Gene Summary | This gene encodes a member of the TALE/TGIF homeobox family of transcription factors. This gene lies within the male specific region of chromosome Y, in a block of sequence that is thought to be the result of a large X-to-Y transposition. The C-terminus of this protein is divergent from that of its chromosome X homolog (TGIF2LX), suggesting that this protein may act as a regulator of TGIF2LX. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221598 | TGIF2LY (Myc-DDK-tagged)-Human TGFB-induced factor homeobox 2-like, Y-linked (TGIF2LY) |
CNY 2400.00 |
|
| RC221598L3 | Lenti ORF clone of Human TGFB-induced factor homeobox 2-like, Y-linked (TGIF2LY), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC221598L4 | Lenti ORF clone of Human TGFB-induced factor homeobox 2-like, Y-linked (TGIF2LY), mGFP tagged |
CNY 5890.00 |
|
| RG221598 | TGIF2LY (tGFP-tagged) - Human TGFB-induced factor homeobox 2-like, Y-linked (TGIF2LY) |
CNY 4370.00 |
其它TGIF2LY产品
