MYEOV2 (COPS9) (NM_138336) Human Untagged Clone
CAT＃: SC306012
MYEOV2 (untagged)-Human myeloma overexpressed 2 (MYEOV2), transcript variant 1
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CSNAP; MYEOV2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306012 representing NM_138336.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGGCGCGCGCCGGAAGCGGCTCTGAGGCCGGAAGTGAGCCTAGAGCGCCGCGGCCCCGAGATGAAG CCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGGACCTGGACGAGGTGGCACGGGCC CGGCGGGAGTCTCCGAGCGCGGGAGGCAGCACCGGGCTCTTGATGGACTTGGCAGCCAATGAAAAGGCC GTTCATGCAGACTTTTTTAACGATTTTGAAGATCTTTTTGATGATGATGACATCCACAGCTCAGGACTG CCCAGGACAAGCCAGCAGTCCTCCATGGTTCCCGCACTGCAGCGAGGGCAGTCGGAGCACGGGGTCCGT GGGAAGGCAGCAGAGCGGCCTGTGGTGTCGGAAGAGAGATGTGAACTGAACGGGAGAGAAGTGGCAGCT TTGGACAGAGCGTTTGGGAGCACAGGCCATGGGCAGGGGGCGGAGGCGCTAATGTTTACCAGATGCAGA GAACATCCGCTGTGTGGCACCAACAAAGCAACAAGTGAGGGGAAAATGGGCACAGGACGCTTAAGAAAC AGTTTACGGAAGAACCAATCCAAGTGGCTGGGAAGTTATCTAGAGGTGCTCAGAACCACAAGAAGCAGG CGAGAGGTCAGCGAAGACAGCACAATATCAGTTTCTACTCACTGGAGGGGTAAATGTTTTAAGAGTGAT GAAACACCATCCGTTGCTGGTGGAGAAGAAGGGAAGAAGACCACACAGCCATGCATAGATGTGAGGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_138336 |
| Insert Size | 759 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138336.1 |
| RefSeq Size | 759 bp |
| RefSeq ORF | 759 bp |
| Locus ID | 150678 |
| UniProt ID | Q8WXC6 |
| MW | 27.7 kDa |
| Gene Summary | Isoform 1: Component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8/ICSBP, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. Plays a role in cell proliferation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212080 | MYEOV2 (Myc-DDK-tagged)-Human myeloma overexpressed 2 (MYEOV2), transcript variant 1 |
CNY 2400.00 |
|
| RC212080L3 | Lenti ORF clone of Human myeloma overexpressed 2 (MYEOV2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212080L4 | Lenti ORF clone of Human myeloma overexpressed 2 (MYEOV2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG212080 | MYEOV2 (tGFP-tagged) - Human myeloma overexpressed 2 (MYEOV2), transcript variant 1 |
CNY 4370.00 |
