Synapsin III (SYN3) (NM_133633) Human Untagged Clone
CAT＃: SC305975
SYN3 (untagged)-Human synapsin III (SYN3), transcript variant IIIc
CNY 7130.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_133633, the custom clone sequence may differ by one or more nucleotides
ATGAATTTCCTCCGGCGACGTCTCTCTGACAGCAGCTTCATGGCCAACCTGCCTAATGGC TATATGACGGACCTGCAACGCCCAGATAGCTCCACCAGCTCACCTGCTTCCCCCGCCATG GAGAGGAGGCACCCCCAGCCCCTGGCTGCCTCCTTCTCCTCTCCAGGATCCAGCCTTTTT AGCTCCCTCTCCAGTGCCATGAAGCAGGCCCCTCAGGCCACCTCAGGACTGATGGAGCCT CCAGGTCCCTCCACGCCCATTGTTCAAAGACCCAGGATCCTGTTGGTGATCGATGATGCC CATACAGACTGGTCGAAGTATTTCCATGGGAAGAAGGTGAATGGAGAGATTGAGATCCGA GTGGAGCAGGCTGAATTCTCAGAGTTGAACCTAGCTGCCTATGTGACCGGGGGCTGCATG GTGGACATGCAGGTCGTGAGAAATGGGACCAAAGTGGTGAGCAGATCCTTCAAGCCAGAC TTCATCCTGGTCCGCCAGCATGCCTACAGCATGGCCCTGGGGGAAGACTACCGCAGCCTG GTCATCGGCCTGCAGTATGGAGGGCTGCCTGCTGTCAACTCTCTCTACTCCGTCTACAAC TTCTGCAGCAAGCCCTGGGTGTTCTCTCAGCTCATTAAGATCTTCCATTCCCTGGGTCCT GAGAAGTTCCCGCTTGTGGAGCAAACATTTTTCCCCAACCATAAGCCAATGGTCACAGCC CCACACTTCCCGGTGGTAGTCAAGCTGGGACATGCCCACGCTGGAATGGGAAAGATCAAA GTGGAAAACCAGCTTGACTTCCAGGACATCACCAGCGTGGTCGCCATGGCCAAAACCTAC GCCACCACCGAGGCCTTCATCGACTCCAAGTACGACATCCGCATCCAGAAAATTGGATCC AACTACAAGGCTTACATGAGAACCTCCATCTCTGGGAACTGGAAGGCCAACACAGGCTCT GCCATGCTGGAGCAGGTGGCCATGACAGAGAGGTACAGGCTGTGGGTGGACAGCTGCTCG GAAATGTTTGGCGGCCTGGACATCTGTGCCGTCAAGGCTGTCCACAGCAAGGATGGCAGA GATTACATCATCGAGGTAATGGACAGCTCAATGCCGCTGATTGGAGAGCATGTGGAAGAG GACAGACAGCTGATGGCCGACCTTGTTGTCTCCAAAATGAGCCAGCTCCCGATGCCAGGA GGCACAGCGCCCTCCCCCCTCAGACCTTGGGCTCCACAGATTAAATCAGCGAAATCCCCA GGGCAAGCCCAGCTGGGGCCTCAGCTAGGCCAGCCCCAGCCACGCCCACCTCCGCAAGCA AATCTCAGTCCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_133633 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_133633.1, NP_598344.1 |
| RefSeq Size | 2626 bp |
| RefSeq ORF | 1335 bp |
| Locus ID | 8224 |
| UniProt ID | O14994 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (IIIc) lacks exon 12, which results in a frameshift and early stop codon compared to variant IIIa. The encoded isoform (IIIc) lacks domains J and E, as compared to the full-length isoform IIIa. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219673 | SYN3 (Myc-DDK-tagged)-Human synapsin III (SYN3), transcript variant IIIc |
CNY 3656.00 |
|
| RC219673L3 | Lenti-ORF clone of SYN3 (Myc-DDK-tagged)-Human synapsin III (SYN3), transcript variant IIIc |
CNY 5890.00 |
|
| RC219673L4 | Lenti-ORF clone of SYN3 (mGFP-tagged)-Human synapsin III (SYN3), transcript variant IIIc |
CNY 5890.00 |
|
| RG219673 | SYN3 (tGFP-tagged) - Human synapsin III (SYN3), transcript variant IIIc |
CNY 4370.00 |
其它Synapsin III产品
