XAGE3 (NM_133179) Human Untagged Clone

CAT#: SC305933

XAGE3 (untagged)-Human X antigen family, member 3 (XAGE3), transcript variant 1



  "NM_133179" in other vectors (4)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT12.3a; CT12.3b; GAGED4; PLAC6; pp9012; XAGE-3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_133179 edited
GAATTCGGCCATTACGGCCGGGGGTGGTGAATGCCCTGGAGTTGTGAGGGTGTGAGGGTC
GCGTTCCTGCTGTCTGGACTTTTTCTGTCCCACTGAGACGCAGCTGTGTGAAATATGATT
TGGCGAGGAAGATCAACATATAGGCCTAGGCCGAGGAGAAGTGTACCACCTCCTGAGCTG
ATTGGGCCTATGCTGGAGCCCGGTGATGAGGAGCCTCAGCAAGAGGAACCACCAACTGAA
AGTCGGGATCCTGCACCTGGTCAGGAGAGAGAAGAAGATCAGGGTGCAGCTGAGACTCAA
GTGCCTGACCTGGAAGCTGATCTCCAGGAGCTGTCTCAGTCAAAGACTGGGGGTGAATGT
GGAAATGGTCCTGATGACCAGGGGAAGATTCTGCCAAAATCAGAACAATTTAAAATGCCA
GAAGGAGGTGACAGGCAACCACAGGTTTAAATGAAGACAAGCTGAAACAACACAAAACTG
TTTTTATCTAAGATATTTGACTTAAAAATATCGAAATAAACTTTTGCAGCTTTCTCCTAA
AAAAAAAAAAAAAAAAAAAAAAAAAACATGTCGGCCGCCTCGGCCCCTCGAG
Restriction Sites Please inquire     
ACCN NM_133179
Insert Size 600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It was fully sequenced and the DNA sequence matches with that of NM_133179.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_133179.1, NP_573440.1
RefSeq Size 523 bp
RefSeq ORF 336 bp
Locus ID 170626
UniProt ID Q8WTP9
Gene Summary This gene is a member of the XAGE subfamily, which belongs to the GAGE family. The GAGE genes are expressed in a variety of tumors and in some fetal and reproductive tissues. This gene is expressed in placenta and fetal liver/spleen, and may function in inhibiting cancer cell growth. The protein encoded by this gene shares a sequence similarity with other GAGE/PAGE proteins. Because of the expression pattern and the sequence similarity, this protein also belongs to a family of CT (cancer-testis) antigens. Alternative splicing of this gene generates 2 transcript variants differing in the 5' UTR. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) has an alternate exon 1, as compared to variant 2. It thus has a different and longer 5' UTR, but encodes the same protein as variant 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...