CST11 (NM_080830) Human Untagged Clone
CAT＃: SC305858
CST11 (untagged)-Human cystatin 11 (CST11), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CST8L; CTES2; dJ322G13.6; SC13 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC305858 representing NM_080830.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATGGCTGAGCCCTGGCAGGCCCTACAGCTCCTGTTGGCCATTCTATTGACTCTGATGGCCCTCCCC TACCAAGCAAGGAAGAAAACCTTTCTAAGCGTCCATGAAGTGATGGCAGTAGAAAACTATGCGAAGGAC AGCTTGCAGTGGATCACCGACCAGTATAACAAGGAAAGTGATGACAAGTACCACTTCAGGATCTTCCGA GTCCTTAAAGTCCAGAGGCAGCAAGTCAACTGCTTCTTCTCAGTGTTTGCTGTACCCTGGTTTGAACAG TACAAAATTTTGAACAAAAGCTGCAGCAGTGACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_080830 |
| Insert Size | 312 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_080830.2 |
| RefSeq Size | 448 bp |
| RefSeq ORF | 312 bp |
| Locus ID | 140880 |
| UniProt ID | Q9H112 |
| Protein Families | Transmembrane |
| MW | 12.3 kDa |
| Gene Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes an epididymal-specific protein shown to have antimicrobial activity against E. coli. Alternative splicing yields two variants encoding distinct isoforms. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (2) lacks an internal exon, compared to variant 1. The encoded isoform (2) is missing an internal segment, which results in a C-terminal truncation of the cystatin domain compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211680 | CST11 (Myc-DDK-tagged)-Human cystatin 11 (CST11), transcript variant 2 |
CNY 1200.00 |
|
| RC211680L3 | Lenti ORF clone of Human cystatin 11 (CST11), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC211680L4 | Lenti ORF clone of Human cystatin 11 (CST11), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG211680 | CST11 (tGFP-tagged) - Human cystatin 11 (CST11), transcript variant 2 |
CNY 2800.00 |
