CLRN1 (NM_052995) Human Untagged Clone
CAT#: SC305711
CLRN1 (untagged)-Human clarin 1 (CLRN1), transcript variant 4
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RP61; USH3; USH3A |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_052995, the custom clone sequence may differ by one or more nucleotides
ATGCAGGCCCTGCAGCAGCAACCAGTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGC ATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACA GCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGG CTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCC TCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTAT GTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCTGGCTGACTAAAGGCCACAGC TGA |
Restriction Sites | Please inquire |
ACCN | NM_052995 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_052995.2, NP_443721.1 |
RefSeq Size | 1444 bp |
RefSeq ORF | 363 bp |
Locus ID | 7401 |
UniProt ID | P58418 |
Protein Families | Transmembrane |
Gene Summary | This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) contains multiple differences in the UTRs and coding region compared to variant 5. The resulting isoform (c) contains shorter and distinct N- and C-termini, compared to isoform d. Sequence Note: This variant (4) is not currently confirmed by EST evidence. The start codon is located within a different exon, compared to variant 1. Two publications (PMID:12145752 and PMID:11524702) support the existence of variant 4. PMID:12145752 suggests that this variant (4) is a minor variant compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218363 | CLRN1 (Myc-DDK-tagged)-Human clarin 1 (CLRN1), transcript variant 4 |
CNY 4940.00 |
|
RC218363L3 | Lenti-ORF clone of CLRN1 (Myc-DDK-tagged)-Human clarin 1 (CLRN1), transcript variant 4 |
CNY 6840.00 |
|
RC218363L4 | Lenti-ORF clone of CLRN1 (mGFP-tagged)-Human clarin 1 (CLRN1), transcript variant 4 |
CNY 6840.00 |
|
RG218363 | CLRN1 (tGFP-tagged) - Human clarin 1 (CLRN1), transcript variant 4 |
CNY 5420.00 |