TTYH2 (NM_052869) Human Untagged Clone
CAT＃: SC305682
TTYH2 (untagged)-Human tweety homolog 2 (Drosophila) (TTYH2), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C17orf29 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_052869, the custom clone sequence may differ by one or more nucleotides
ATGCAGATCCAGGTCGCGGGGCTGCTGCAGTTTGCCGTGCCCCTCTTCTCCACTGCAGAG GAAGACCTGCTTGCAATCCAGCTCCTGCTGAACTCCTCAGAGTCCAGCCTTCACCAGCTG ACCGCCATGGTGGACTGCCGAGGGCTGCACAAGGATTATCTGGACGCTCTTGCTGGCATC TGCTACGACGGCCTCCAGGGCTTGCTGTACCTTGGCCTCTTCTCCTTCCTGGCCGCCCTC GCCTTCTCCACCATGATCTGTGCAGGGCCAAGGGCCTGGAAGCACTTCACCACCAGAAAC AGAGACTACGATGACATTGATGATGATGACCCCTTTAACCCCCAAGCCTGGCGCATGGCG GCTCACAGTCCCCCGAGGGGACAGCTTCACAGCTTCTGCAGCTACAGCAGTGGCCTGGGA AGTCAGACCAGCCTGCAGCCCCCGGCCCAGACCATCTCCAACGCCCCTGTCTCCGAGTAC ATGAACCAAGCCATGCTCTTTGGTAGGAACCCACGCTACGAGAACGTGCCACTAATCGGG AGAGCCTCCCCTCCGCCTACGTACTCTCCCAGCATGAGAGCCACCTACCTGTCTGTGGCG GATGAGCACCTGAGGCACTACGGGAATCAGTTTCCAGCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_052869 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_052869.1, NP_443101.1 |
| RefSeq Size | 3278 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 94015 |
| UniProt ID | Q9BSA4 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel, and may play a role in kidney tumorigenesis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. The resulting isoform (2) contains a shorter C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219969 | TTYH2 (Myc-DDK-tagged)-Human tweety homolog 2 (Drosophila) (TTYH2), transcript variant 2 |
CNY 3990.00 |
|
| RC219969L3 | Lenti-ORF clone of TTYH2 (Myc-DDK-tagged)-Human tweety homolog 2 (Drosophila) (TTYH2), transcript variant 2 |
CNY 5890.00 |
|
| RC219969L4 | Lenti-ORF clone of TTYH2 (mGFP-tagged)-Human tweety homolog 2 (Drosophila) (TTYH2), transcript variant 2 |
CNY 5890.00 |
|
| RG219969 | TTYH2 (tGFP-tagged) - Human tweety homolog 2 (Drosophila) (TTYH2), transcript variant 2 |
CNY 4370.00 |
