TRIM10 (NM_052828) Human Untagged Clone

CAT#: SC305675

TRIM10 (untagged)-Human tripartite motif containing 10 (TRIM10), transcript variant 2



  "NM_052828" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-TRIM10 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HERF1; RFB30; RNF9
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305675 representing NM_052828.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTCTGCTGCCTCTGTGACCAGCCTGGCAGATGAAGTCAACTGCCCCATCTGTCAGGGTACCCTG
AGGGAGCCGGTCACTATCGACTGCGGCCACAACTTCTGCCGGGCCTGCCTTACCCGCTACTGTGAGATA
CCAGGCCCAGACCTGGAGGAGTCCCCTACTTGCCCACTCTGCAAAGAACCCTTCCGTCCTGGGAGCTTC
CGGCCCAACTGGCAGCTGGCTAACGTGGTGGAGAACATTGAGCGCCTCCAGCTGGTGTCCACACTGGGT
TTGGGAGAGGAGGATGTCTGCCAAGAGCACGGAGAGAAGATCTACTTCTTCTGTGAGGATGATGAGATG
CAGTTGTGCGTGGTGTGCCGGGAGGCTGGGGAGCACGCTACCCACACCATGCGCTTCCTGGAGGATGCA
GCGGCTCCCTATAGGGAACAAATCCATAAGTGTCTTAAATGTCTAAGAAAAGAGAGAGAGGAGATTCAA
GAAATCCAGTCAAGAGAAAATAAAAGGATGCAAGTCCTCCTGACTCAGGTGTCCACCAAGAGACAACAG
GTGATTTCTGAGTTCGCACACCTGAGGAAGTTTCTAGAGGAACAGCAGAGCATCCTCTTAGCACAATTG
GAGAGCCAGGATGGGGACATCTTGAGGCAACGGGATGAATTTGATTTGCTGGTTGCTGGGGAGATCTGC
CGGTTTAGTGCTCTTATTGAAGAACTGGAGGAGAAGAATGAGAGGCCAGCAAGGGAGCTCCTGACGGAC
ATCAGAAGCACTCTAATAAGATGTGAAACCAGAAAGTGCCGGAAACCGGTGGCTGTGTCGCCAGAGCTG
GGCCAGAGGATTCGGGACTTTCCCCAGCAGGCCCTCCCGCTGCAGAGGGAGATGAAGATGTTTCTGGAA
AAACTATGCTTTGAGTTGGACTATGAGCCAGCTCACATTTCTCTAGACCCTCAGACTTCCCACCCCAAG
CTCCTCTTGTCCGAGGACCACCAGCGAGCTCAGTTCTCCTACAAATGGCAGAACTCACCAGACAACCCC
CAACGTTTTGACCGGGCCACCTGTGTTCTGGCCCACACTGGCATCACAGGGGGGAGACACACGTGGGTG
TGGATGGCCAGGGTACCTGGGGACTCAGGCTGCTGCCAGTTCTGCTCACCACCATCCGTGCTTGGCACA
GAAGTAGCTGCATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_052828
Insert Size 1188 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_052828.2
RefSeq Size 3033 bp
RefSeq ORF 1188 bp
Locus ID 10107
UniProt ID Q9UDY6
Protein Families Druggable Genome
MW 45.3 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice site that results in the introduction of a 539 nt intron between a 3' penultimate and 3' terminal exon, compared to the 3' terminal exon of variant 1. This results in a frameshift and introduction of a novel stop codon. Isoform 2 has a distinct C-terminus and is 86 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...