CFC1 (NM_032545) Human Untagged Clone

CAT#: SC305469

CFC1 (untagged)-Human cripto, FRL-1, cryptic family 1 (CFC1)



  "NM_032545" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CFC1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CFC1B; CRYPTIC; DTGA2; HTX2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_032545 edited
GGCTGAGGAAGGGAAGGGAACATCCACATCTTCTGTACTCGTCCATTCTGTGTCCCCGGG
GCCTGGAGTAAAGACACCTTCAAATGCAGAGACTCTTCAGATTCAGCTTTCCTGGAAACT
GATCTTCAATGCACTAAGAGAAGGAGACTCTCAAACCAAAAATGACCTGGAGGCACCATG
TCAGGCTTCTGTTTACGGTCAGTTTGGCATTACAGATCATCAATTTGGGAAACAGCTATC
AAAGAGAGAAACATAACGGCGGTAGAGAGGAAGTCACCAAGGTTGCCACTCAGAAGCACC
GACAGTCACCGCTCAACTGGACCTCCAGTCATTTCGGAGAGGTGACTGGGAGCGCCGAGG
GCTGGGGGCCGGAGGAGCCGCTCCCCTACTCCCGGGCTTTCGGAGAGGGTGCGTCCGCGC
GGCCGCGCTGCTGCAGGAACGGCGGTACCTGCGTGCTGGGCAGCTTCTGCGTGTGCCCGG
CCCACTTCACCGGCCGCTACTGCGAGCATGACCAGAGGCGCAGTGAATGCGGCGCCCTGG
AGCACGGAGCCTGGACCCTCCGCGCCTGCCACCTCTGCAGGTGCATCTTCGGGGCCCTGC
ACTGCCTCCCCCTCCAGACGCCTGACCGCTGTGACCCGAAAGACTTCCTGGCCTCCCACG
CTCACGGGCCGAGCGCCGGGGGCGCGCCCAGCCTGCTACTCTTGCTGCCCTGCGCACTCC
TGCACCGCCTCCTGCGCCCGGATGCGCCCGCGCACCCTCGGTCCCTGGTCCCTTCCGTCC
TCCAGCGGGAGCGGCGCCCCTGCGGAAGGCCGGGACTTGGGCATCGCCTTTAATTTTCTA
TGTTGTAAATAATAGATGTGTTTAGTTTACCGTAAGCTGAAGCACTGGGTGAATATTTTT
ATTGGGTAATAAATATTTTCATGAAAGCGCCTTTGGCTCCAGAT
Restriction Sites Please inquire     
ACCN NM_032545
Insert Size 900 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032545.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_032545.2, NP_115934.1
RefSeq Size 1009 bp
RefSeq ORF 672 bp
Locus ID 55997
UniProt ID P0CG37
Gene Summary This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...