LY6G5C (NM_025262) Human Untagged Clone

CAT#: SC305259

LY6G5C (untagged)-Human lymphocyte antigen 6 complex, locus G5C (LY6G5C)



  "NM_025262" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-LY6G5C Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf20; G5C; LY6G5CA; LY6G5CB; NG33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305259 representing NM_025262.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGTTTTATGGCAGGCCCTGCAGGGAGCCAGAGTCTGGGTCCCCTGTGCTTCCACAGCAGCCCCCAA
GCCCTCTACACGGTCCTCTTAATAGTGCTGGTCATGATGAGCTTGGTGTTTGGTAAGTTTGTTCCTGTC
AATTGGGAACCCCCTCAACCACTTCCATTCCCCAAATACCTGCGCTGCTACCGATGCCTCTTGGAGACC
AAGGAGTTAGGGTGCCTTCTGGGATCTGACATCTGCCTCACCCCAGCTGGCAGCAGCTGCATCACTCTC
CACAAAAAGAACAGCAGCGGTTCTGACGTCATGGTGAGTGACTGCCGAAGTAAGGAGCAGATGAGTGAT
TGTTCAAATACCCGAACTTCTCCGGTGTCTGGCTTCTGGATATTCTCTCAATACTGCTTCCTGGATTTC
TGCAATGACCCTCAAAACAGAGGGCTCTATACTCCTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_025262
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025262.3
RefSeq Size 738 bp
RefSeq ORF 453 bp
Locus ID 80741
UniProt ID Q5SRR4
Protein Families Transmembrane
MW 16.7 kDa
Gene Summary LY6G5C belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (3) encodes the longest isoform (B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...