LY6G6C (NM_025261) Human Untagged Clone
CAT#: SC305258
LY6G6C (untagged)-Human lymphocyte antigen 6 complex, locus G6C (LY6G6C)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C6orf24; G6c; NG24 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305258 representing NM_025261.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAAGCCCTTATGCTGCTCACCCTGTCTGTTCTGCTCTGCTGGGTCTCAGCTGACATTCGCTGTCAC TCCTGCTACAAGGTCCCTGTGCTGGGCTGTGTGGACCGGCAGTCCTGCCGCCTGGAGCCAGGACAGCAA TGCCTGACAACACATGCATACCTTGGTAAGATGTGGGTTTTCTCCAATCTGCGCTGTGGCACACCAGAA GAGCCCTGTCAGGAGGCCTTCAACCAAACCAACCGCAAGCTGGGTCTGACATATAACACCACCTGCTGC AACAAGGACAACTGCAACAGCGCAGGACCCCGGCCCACTCCAGCCCTGGGCCTTGTCTTCCTTACCTCC TTGGCTGGCCTTGGCCTCTGGCTGCTGCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_025261 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_025261.2 |
RefSeq Size | 932 bp |
RefSeq ORF | 378 bp |
Locus ID | 80740 |
UniProt ID | O95867 |
Protein Families | Secreted Protein |
MW | 13.8 kDa |
Gene Summary | LY6G6C belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]).[supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216027 | LY6G6C (Myc-DDK-tagged)-Human lymphocyte antigen 6 complex, locus G6C (LY6G6C) |
CNY 1200.00 |
|
RC216027L3 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6C (LY6G6C), Myc-DDK-tagged |
CNY 5890.00 |
|
RC216027L4 | Lenti ORF clone of Human lymphocyte antigen 6 complex, locus G6C (LY6G6C), mGFP tagged |
CNY 5890.00 |
|
RG216027 | LY6G6C (tGFP-tagged) - Human lymphocyte antigen 6 complex, locus G6C (LY6G6C) |
CNY 2800.00 |