CSP (DNAJC5) (NM_025219) Human Untagged Clone
CAT#: SC305246
DNAJC5 (untagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5)
CNY 2400.00
CNY 3990.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CLN4; CLN4B; CSP; DNAJC5A; mir-941-2; mir-941-3; mir-941-4; mir-941-5; NCL |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_025219 edited
AGCCTAACATGGCAGACCAGAGACAGCGCTCACTGTCTACCTCTGGGGAGTCATTGTACC ACGTCCTTGGGTTGGACAAGAACGCAACCTCAGATGACATTAAAAAGTCCTATCGGAAGC TTGCCTTGAAATATCACCCCGACAAGAACCCCGACAACCCGGAGGCCGCGGACAAGTTTA AGGAGATCAACAACGCGCACGCCATCCTCACGGACGCCACAAAAAGGAACATCTACGACA AGTACGGCTCGCTGGGTCTCTACGTGGCCGAGCAGTTTGGGGAAGAGAACGTGAACACCT ACTTCGTGCTGTCCAGCTGGTGGGCCAAGGCCCTGTTTGTCTTCTGCGGCCTCCTCACGT GCTGCTACTGCTGCTGCTGTCTGTGCTGCTGCTTCAACTGCTGCTGCGGGAAGTGTAAGC CCAAGGCGCCTGAAGGCGAGGAGACGGAGTTCTACGTGTCCCCCGAGGATCTGGAGGCAC AGCTGCAGTCTGACGAGAGGGAGGCCACAGACACGCCGATCGTCATACAGCCGGCATCCG CCACCGAGACCACCCAGCTCACAGCCGACTCCCACCCCAGCTACCACACTGACGGGTTCA ACTAAATCCAGGAGGAGCTGTGGTC |
Restriction Sites | Please inquire |
ACCN | NM_025219 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_025219.1, NP_079495.1 |
RefSeq Size | 3286 bp |
RefSeq ORF | 597 bp |
Locus ID | 80331 |
UniProt ID | Q9H3Z4 |
Protein Families | Transmembrane |
Gene Summary | This gene is a member of the J protein family. J proteins function in many cellular processes by regulating the ATPase activity of 70 kDa heat shock proteins. The encoded protein plays a role in membrane trafficking and protein folding, and has been shown to have anti-neurodegenerative properties. The encoded protein is known to play a role in cystic fibrosis and Huntington's disease. A pseudogene of this gene is located on the short arm of chromosome 8. [provided by RefSeq, Nov 2010] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Primary fibroblasts from CSPα mutation carriers recapitulate hallmarks of the adult onset neuronal ceroid lipofuscinosis
,Benitez, BA;Sands, MS;,
Sci Rep
,PubMed ID 28740222
[DNAJC5]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208826 | DNAJC5 (Myc-DDK-tagged)-Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5) |
CNY 2400.00 |
|
RC208826L1 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), Myc-DDK-tagged |
CNY 4800.00 |
|
RC208826L2 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mGFP tagged |
CNY 5890.00 |
|
RC208826L3 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), Myc-DDK-tagged |
CNY 5890.00 |
|
RC208826L4 | Lenti ORF clone of Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5), mGFP tagged |
CNY 5890.00 |
|
RG208826 | DNAJC5 (tGFP-tagged) - Human DnaJ (Hsp40) homolog, subfamily C, member 5 (DNAJC5) |
CNY 4370.00 |