CXXC4 (NM_025212) Human Untagged Clone
CAT#: SC305244
CXXC4 (untagged)-Human CXXC finger protein 4 (CXXC4)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IDAX |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_025212 edited
ATGCACCACCGAAACGACTCCCAGAGGCTGGGGAAAGCTGGCTGCCCGCCAGAGCCGTCG TTGCAAATGGCAAATACTAATTTCCTCTCCACCTTATCCCCTGAACACTGCAGACCTTTG GCGGGGGAATGCATGAACAAGCTCAAATGCGGCGCTGCTGAAGCAGAGATAATGAATCTC CCCGAGCGCGTGGGGACTTTTTCCGCTATCCCGGCTTTAGGGGGCATCTCATTACCTCCA GGGGTCATCGTCATGACAGCCCTTCACTCCCCCGCAGCAGCCTCAGCAGCCGTCACAGAC AGTGCGTTTCAAATTGCCAATCTGGCAGACTGCCCGCAGAATCATTCCTCCTCCTCCTCG TCCTCCTCAGGGGGAGCTGGCGGAGCCAACCCAGCCAAGAAGAAGAGGAAAAGGTGTGGG GTCTGCGTGCCCTGCAAGAGGCTCATCAACTGTGGCGTCTGCAGCAGTTGCAGGAACCGC AAAACGGGACACCAGATCTGCAAATTTAGAAAATGTGAAGAGCTAAAGAAAAAACCTGGC ACTTCACTAGAGAGAACACCTGTTCCCAGCGCTGAAGCATTCCGATGGTTCTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_025212 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_025212.1, NP_079488.1 |
RefSeq Size | 761 bp |
RefSeq ORF | 597 bp |
Locus ID | 80319 |
Protein Families | Druggable Genome |
Protein Pathways | Wnt signaling pathway |
Gene Summary | This gene encodes a CXXC-type zinc finger domain-containing protein that functions as an antagonist of the canonical wingless/integrated signaling pathway. The encoded protein negatively regulates wingless/integrated signaling through interaction with the post synaptic density protein/ Drosophila disc large tumor suppressor/ zonula occludens-1 protein domain of Dishevelled, a scaffolding protein required for the stabilization of the transcriptional co-activator beta-catenin. In addition, the CXXC domain of this protein has been shown to bind unmethylated CpG dinucleotides, localize to promoters and CpG islands, and interact with the catalytic domain of methylcytosine dioxygenase ten-eleven-translocation 2, an iron and alpha-ketoglutarate-dependent dioxygenase that modifies the methylation status of DNA. In humans, a mutation in this gene has been associated with development of malignant renal cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212834 | CXXC4 (Myc-DDK-tagged)-Human CXXC finger protein 4 (CXXC4) |
CNY 2400.00 |
|
RC212834L3 | Lenti ORF clone of Human CXXC finger protein 4 (CXXC4), Myc-DDK-tagged |
CNY 5890.00 |
|
RC212834L4 | Lenti ORF clone of Human CXXC finger protein 4 (CXXC4), mGFP tagged |
CNY 5890.00 |
|
RG212834 | CXXC4 (tGFP-tagged) - Human CXXC finger protein 4 (CXXC4) |
CNY 4000.00 |