GPR110 (ADGRF1) (NM_025048) Human Untagged Clone

CAT#: SC305221

GPR110 (untagged)-Human G protein-coupled receptor 110 (GPR110), transcript variant 2



  "NM_025048" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ADGRF1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPR110; hGPCR36; KPG_012; PGR19
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_025048 edited
CCAGGGAAAATGAAAGTTGGAGTGCTGTGGCTCATTTCTTTCTTCACCTTCACTGACGGC
CACGGTGGCTTCCTGGGGAAAAATGATGGCATCAAAACAAAAAAAGAACTCATTGTGAAT
AAGAAAAAACATCTAGGCCCAGTCGAAGAATATCAGCTGCTGCTTCAGGTGACCTATAGA
GATTCCAAGGAGAAAAGAGATTTGAGAAATTTTCTGAAGCTCTTGAAGCCTCCATTATTA
TGGTCACATGGGCTAATTAGAATTATCAGAGCAAAGGCTACCACAGACTGCAACAGCCTG
AATGGAGTCCTGCAGTGTACCTGTGAAGACAGCTACACCTGGTTTCCTCCCTCATGCCTT
GATCCCCAGAACTGCTACCTTCACACGGCTGGAGCACTCCCAAGCTGTGAATGTCATCTC
AACAACCTCAGCCAGAGTGTCAATTTCTGTGAGAGAACAAAGATTTGGGGCACTTTCAAA
ATTAATGAAAGGTTTACAAATGACCTTTTGAATTCATCTTCTGCTATATACTCCAAATAT
GCAAATGGAATTGAAATTCAACTTAAAAAAGCATATGAAAGAATTCAAGGTTTTGAGTCG
GTTCAGGTCACCCAATTTCGAATGTCACTCTTGTCGCCCAAGTTGGAGTGCAATGGCACA
ATCTAG
Restriction Sites Please inquire     
ACCN NM_025048
Insert Size 650 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation ORF was fully sequenced and it perfectly matches with NM_025048.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025048.2, NP_079324.2
RefSeq Size 1437 bp
RefSeq ORF 657 bp
Locus ID 266977
UniProt ID Q5T601
Protein Families Druggable Genome, Transmembrane
Gene Summary Orphan receptor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate 3'-terminal exon, compared to variant 1, resulting in the shorter isoform (2) with a unique C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...