ELOVL7 (NM_024930) Human Untagged Clone
CAT#: SC305195
ELOVL7 (untagged)-Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1
CNY 3600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC105772 sequence for XM_041701 edited (data generated by NextGen Sequencing)
ATGCCGTGGACCTGGTGGTTTGGAGTCAAATTTGCTGCAGGTGGTTTGGGAACATTCCAT GCCCTTCTAAATACAGCTGTACATGTAGTCATGTATTCCTACTATGGACTTTCTGCATTG GGGCCAGCCTACCAGAAGTATTTGTGGTGGAAAAAATATTTGACATCATTACAGCTTGTC CAGTTTGTTATTGTCGCCATCCACATAAGCCAGTTCTTTTTCATGGAGGATTGCAAGTAT CAGTTTCCAGTCTTTGCGTGCATCATTATGAGTTACAGTTTCATGTTTCTGCTGCTCTTT CTCCATTTTTGGTACCGTGCTTACACCAAAGGTCAGAGGTTGCCCAAAACTGTGAAAAAT GGAACTTGCAAAAACAAAGATAATTGA Clone variation with respect to XM_041701.5 |
Restriction Sites | NotI-NotI |
ACCN | NM_024930 |
Insert Size | 3900 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_024930.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_024930.1, NP_079206.1 |
RefSeq Size | 3815 bp |
RefSeq ORF | 846 bp |
Locus ID | 79993 |
UniProt ID | A1L3X0 |
Protein Families | Transmembrane |
Gene Summary | Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme with higher activity toward C18 acyl-CoAs, especially C18:3(n-3) acyl-CoAs and C18:3(n-6)-CoAs. Also active toward C20:4-, C18:0-, C18:1-, C18:2- and C16:0-CoAs, and weakly toward C20:0-CoA. Little or no activity toward C22:0-, C24:0-, or C26:0-CoAs. May participate in the production of saturated and polyunsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Both variants 1 and 2 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217151 | ELOVL7 (Myc-DDK-tagged)-Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1 |
CNY 3600.00 |
|
RC217151L1 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
RC217151L2 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC217151L3 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1, Myc-DDK-tagged |
CNY 6000.00 |
|
RC217151L4 | Lenti ORF clone of Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1, mGFP tagged |
CNY 6000.00 |
|
RG217151 | ELOVL7 (tGFP-tagged) - Human ELOVL fatty acid elongase 7 (ELOVL7), transcript variant 1 |
CNY 5200.00 |