ADM2 (NM_024866) Human Untagged Clone
CAT#: SC305170
ADM2 (untagged)-Human adrenomedullin 2 (ADM2)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AM2; dJ579N16.4 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_024866 edited
CCGCCCGCCATGGCCCGGATCCCGACGGCCGCCCTGGGTTGCATCAGCCTCCTCTGCCTG CAGCTCCCTGGCTCGCTGTCCCGCAGCCTGGGCGGGGACCCGCGACCCGTCAAACCCAGG GAGCCCCCAGCCCGGAGCCCTTCCAGCAGCCTGCAGCCCAGGCACCCCGCACCCCGACCT GTGGTCTGGAAGCTTCACCGGGCCCTCCAGGCACAGAGGGGTGCCGGCCTGGCCCCTGTT ATGGGTCAGCCTCTCCGGGATGGTGGCCGCCAACACTCGGGCCCCCGAAGACACTCGGGC CCCCGCAGGACCCAAGCCCAGCTCCTGCGAGTGGGCTGTGTGCTGGGCACCTGCCAGGTG CAGAATCTCAGCCACCGCCTGTGGCAACTCATGGGACCGGCCGGCCGGCAGGACTCAGCT CCTGTGGACCCCAGCAGCCCCCACAGCTATGGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_024866 |
Insert Size | 456 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It is not a varient. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_024866.3, NP_079142.2 |
RefSeq Size | 4063 bp |
RefSeq ORF | 447 bp |
Locus ID | 79924 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis, prolactin release, anti-diuresis, anti-natriuresis, and regulation of food and water intake. The encoded protein is proteolytically processed to generate one or more biologically active peptides. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216633 | ADM2 (Myc-DDK-tagged)-Human adrenomedullin 2 (ADM2) |
CNY 1200.00 |
|
RC216633L1 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), Myc-DDK-tagged |
CNY 3600.00 |
|
RC216633L2 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), mGFP tagged |
CNY 5890.00 |
|
RC216633L3 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), Myc-DDK-tagged |
CNY 5890.00 |
|
RC216633L4 | Lenti ORF clone of Human adrenomedullin 2 (ADM2), mGFP tagged |
CNY 5890.00 |
|
RG216633 | ADM2 (tGFP-tagged) - Human adrenomedullin 2 (ADM2) |
CNY 2800.00 |