ODF1 (NM_024410) Human Untagged Clone
CAT#: SC305112
ODF1 (untagged)-Human outer dense fiber of sperm tails 1 (ODF1)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT133; HSPB10; ODF; ODF2; ODF27; ODFP; ODFPG; ODFPGA; ODFPGB; RT7; SODF |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC305112 representing NM_024410.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCACTGAGTTGTCTCTTGGACAGTGTCAGAAGGGACATAAAGAAGGTGGACAGAGAACTAAGG CAACTGAGATGCATCGACGAATTTAGCACACGGTGCCTGTGCGACTTGTATATGCACCCCTATTGCTGC TGTGACTTGCACCCATATCCGTACTGCTTGTGCTATTCCAAGCGATCACGCTCTTGCGGCCTGTGTGAT CTCTACCCATGTTGCCTGTGTGATTATAAGCTTTACTGTCTGCGACCATCTCTCAGAAGTTTGGAGAGG AAAGCCATCAGAGCCATAGAAGATGAGAAGCGAGAGCTTGCCAAACTGAGAAGAACAACAAATAGAATT CTGGCTTCCTCCTGCTGTAGCAGTAACATTTTAGGATCGGTGAATGTATGCGGTTTTGAACCCGATCAA GTCAAAGTTCGAGTGAAGGATGGAAAGGTATGTGTGTCGGCTGAGCGGGAGAACAGGTACGACTGCCTT GGATCGAAAAAGTACAGCTACATGAACATCTGCAAAGAGTTCAGCTTGCCGCCCTGTGTGGATGAGAAG GATGTAACATACTCCTATGGGCTCGGCAGCTGTGTCAAGATCGAGTCTCCTTGCTACCCTTGCACTTCT CCTTGCAGCCCCTGCAGCCCCTGCAGCCCCTGCAACCCCTGCAGCCCCTGCAACCCGTGCAGCCCATAT GATCCTTGCAACCCGTGTTATCCCTGTGGAAGCCGATTTTCCTGTAGGAAGATGATTTTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_024410 |
| Insert Size | 753 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_024410.3 |
| RefSeq Size | 1007 bp |
| RefSeq ORF | 753 bp |
| Locus ID | 4956 |
| UniProt ID | Q14990 |
| MW | 28.4 kDa |
| Gene Summary | The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. The human outer dense fibers contains at least 10 major proteins and this gene encodes the main protein. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215265 | ODF1 (Myc-DDK-tagged)-Human outer dense fiber of sperm tails 1 (ODF1) |
CNY 2400.00 |
|
| RC215265L3 | Lenti ORF clone of Human outer dense fiber of sperm tails 1 (ODF1), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC215265L4 | Lenti ORF clone of Human outer dense fiber of sperm tails 1 (ODF1), mGFP tagged |
CNY 5890.00 |
|
| RG215265 | ODF1 (tGFP-tagged) - Human outer dense fiber of sperm tails 1 (ODF1) |
CNY 4000.00 |
