PRRG3 (NM_024082) Human Untagged Clone
CAT#: SC305098
PRRG3 (untagged)-Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PRGP3; TMG3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305098 representing NM_024082.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGTGTTTCTGGAGGCCAAGGATGCCCATTCGGTCCTGAAACGATTCCCTCGTGCCAATGAGTTC CTGGAGGAGCTGCGCCAGGGCACCATCGAGCGAGAGTGCATGGAGGAGATCTGCAGCTACGAGGAGGTC AAGGAAGTGTTTGAGAACAAAGAGAAAACGATGGAGTTCTGGAAAGGGTACCCAAATGCAGTCTACTCT GTCCGAGACCCCTCGCAGAGCTCAGATGCCATGTATGTGGTGGTACCCCTTCTGGGGGTGGCACTGCTG ATTGTCATCGCCTTGTTCATCATCTGGAGGTGCCAGCTGCAGAAAGCGACCCGTCACCACCCCTCCTAT GCTCAGAACCGGTACCTAGCCAGTCGCGCCGGGCACACCCTCCCCCGGGTCATGGTGTACCGGGGTACT GTGCATAGCCAAGGGGAGCCTTCTGGGCACCGAGAGGCAGCGAACAGCCCCCAGGTGGTGCTGGGGCCC AGTCGGGGGGGCAGGACCACAGTCCGGCTAGAGAGCACCCTCTACCTCCCTGAGCTCTCTCTCTCCAGA CTGTCCAGCACCACCCCTCCCCCCTCCTACGAGGAGGTGACTGCGCCCCAAGAGAGCAGCAGTGAGGAG GCCAGCGTGTCTTACAGTGACCCACCCCCAAAGTACGAGGAGATAGTGGCCGCCAACCCTGGCGCTGAC AAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_024082 |
Insert Size | 696 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_024082.3 |
RefSeq Size | 1303 bp |
RefSeq ORF | 696 bp |
Locus ID | 79057 |
UniProt ID | Q9BZD7 |
Protein Families | Transmembrane |
MW | 25.9 kDa |
Gene Summary | This gene encodes a protein which contains a vitamin K-dependent carboxylation/gamma-carboxyglutamic domain. The encoded protein is a member of a family of vitamin K-dependent transmembrane proteins which contain a glutamate-rich extracellular domain. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217565 | PRRG3 (Myc-DDK-tagged)-Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2 |
CNY 2,400.00 |
|
RC217565L1 | Lenti ORF clone of Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC217565L2 | Lenti ORF clone of Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC217565L3 | Lenti ORF clone of Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217565L4 | Lenti ORF clone of Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG217565 | PRRG3 (tGFP-tagged) - Human proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) (PRRG3), transcript variant 2 |
CNY 4,000.00 |