METTL1 (NM_023033) Human Untagged Clone
CAT#: SC305072
METTL1 (untagged)-Human methyltransferase like 1 (METTL1), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C12orf1; TRM8; TRMT8; YDL201w |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305072 representing NM_023033.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCAGCCGAGACTCGGAACGTGGCCGGAGCAGAGGCCCCACCGCCCCAGAAGCGCTACTACCGGCAA CGTGCTCACTCCAACCCCATGGCGGACCACACGCTGCGCTACCCTGTGAAGCCAGAGGAGATGGACTGG TCTGAGCTATACCCAGAGTTCTTCGCTCCACTCACTCAAAATCAGAGCCACGATGACCCAAAGGATAAG AAAGAAAAGAGAGCTCAGGCCCAAGTGGAGTTTGCAGACATAGGCTGTGGCTATGGTGGCCTGTTAGCT GACAAAGATGTTCTTCCTCTTCCCCGACCCACATTTCAAGCGGACAAAGCACAAGTGGCGAATCATCAG TCCCACCCTGCTAGCAGAATATGCCTACGTGCTAAGAGTTGGGGGGCTGGTGTATACCATAACCGATGT GCTGGAGCTACACGACTGGATGTGCACTCATTTCGAAGAGCACCCACTGTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_023033 |
Insert Size | 468 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023033.3 |
RefSeq Size | 1126 bp |
RefSeq ORF | 468 bp |
Locus ID | 4234 |
UniProt ID | Q9UBP6 |
Protein Families | Druggable Genome |
MW | 17.4 kDa |
Gene Summary | This gene is similar in sequence to the S. cerevisiae YDL201w gene. The gene product contains a conserved S-adenosylmethionine-binding motif and is inactivated by phosphorylation. Alternative splice variants encoding different protein isoforms have been described for this gene. A pseudogene has been identified on chromosome X. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an alternate segment, compared to variant 1, that causes a frameshift. The resulting protein (isoform c) has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217741 | METTL1 (Myc-DDK-tagged)-Human methyltransferase like 1 (METTL1), transcript variant 3 |
CNY 1200.00 |
|
RC217741L3 | Lenti ORF clone of Human methyltransferase like 1 (METTL1), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217741L4 | Lenti ORF clone of Human methyltransferase like 1 (METTL1), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG217741 | METTL1 (tGFP-tagged) - Human methyltransferase like 1 (METTL1), transcript variant 3 |
CNY 4370.00 |