CYP3A43 (NM_022820) Human Untagged Clone
CAT#: SC305055
CYP3A43 (untagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1
CNY 5640.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022820, the custom clone sequence may differ by one or more nucleotides
ATGGATCTCATTCCAAACTTTGCCATGGAAACATGGGTTCTTGTGGCTACCAGCCTGGTACTCCTCTATA TTTATGGGACCCATTCACATAAACTTTTTAAGAAGCTGGGAATTCCTGGGCCAACCCCTCTGCCTTTTCT GGGAACTATTTTGTTCTACCTTAGGGGTCTTTGGAATTTTGACAGAGAATGTAATGAAAAATACGGAGAA ATGTGGGGGCTGTATGAGGGGCAACAGCCCATGCTGGTCATCATGGATCCCGACATGATCAAAACAGTGT TAGTGAAAGAATGTTACTCTGTCTTCACAAACCAGATGCCTTTAGGTCCAATGGGATTTCTGAAAAGTGC CTTAAGTTTTGCTGAAGATGAAGAATGGAAGAGAATACGAACATTGCTATCTCCAGCTTTCACCAGTGTA AAATTCAAGGAAATGGTCCCCATCATTTCCCAATGTGGAGATATGTTGGTGAGAAGCCTGAGGCAGGAAG CAGAGAACAGCAAGTCCATCAACTTGAAAGATTTCTTTGGGGCCTACACCATGGATGTAATCACTGGCAC ATTATTTGGAGTGAACTTGGATTCTCTCAACAATCCACAAGATCCCTTTCTGAAAAATATGAAGAAGCTT TTAAAATTGGATTTTTTGGATCCCTTTTTACTCTTAATATCACTCTTTCCATTTCTTACCCCAGTTTTTG AAGCCCTAAATATCGGTTTGTTTCCAAAAGATGTTACCCATTTTTTAAAAAATTCCATTGAAAGGATGAA AGAAAGTCGCCTCAAAGATAAACAAAAGCATCGAGTAGATTTCTTTCAACAGATGATCGACTCCCAGAAT TCCAAAGAAACAAAGTCCCATAAAGCTCTGTCTGATCTGGAGCTTGTGGCCCAGTCAATTATCATCATTT TTGCTGCCTATGACACAACTAGCACCACTCTCCCCTTCATTATGTATGAACTGGCCACTCACCCTGATGT CCAGCAGAAACTGCAGGAGGAGATTGACGCAGTTTTACCCAATAAGGCACCTGTCACCTACGATGCCCTG GTACAGATGGAGTACCTTGACATGGTGGTGAATGAAACGCTCAGATTATTCCCAGTTGTTAGTAGAGTTA CGAGAGTCTGCAAGAAAGATATTGAAATCAATGGAGTGTTCATTCCCAAAGGGTTAGCAGTGATGGTTCC AATCTATGCTCTTCACCATGACCCAAAGTACTGGACAGAGCCTGAGAAGTTCTGCCCTGAAAGTAGGTTC AGTAAGAAGAACAAGGACAGCATAGATCTTTACAGATACATACCTTTTGGAGCTGGACCCCGAAACTGCA TTGGCATGAGGTTTGCTCTCACAAACATAAAACTTGCTGTCATTAGAGCACTGCAGAACTTCTCCTTCAA ACCTTGTAAAGAGACTCAGATCCCACTGAAATTAGACAATCTACCAATTCTTCAACCAGAAAAACCTATT GTTCTAAAAGTGCACTTAAGAGATGGGATTACAAGTGGACCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_022820 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022820.3, NP_073731.1 |
RefSeq Size | 2167 bp |
RefSeq ORF | 1515 bp |
Locus ID | 64816 |
UniProt ID | Q9HB55 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism |
Gene Summary | This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein has a low level of testosterone hydroxylase activity, and may play a role in aging mechanisms and cancer progression. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219323 | CYP3A43 (Myc-DDK-tagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1 |
CNY 5632.00 |
|
RC219323L1 | Lenti ORF clone of Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1, Myc-DDK-tagged |
CNY 8032.00 |
|
RC219323L2 | Lenti ORF clone of Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1, mGFP tagged |
CNY 6370.00 |
|
RC219323L3 | Lenti ORF clone of Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1, Myc-DDK-tagged |
CNY 6370.00 |
|
RC219323L4 | Lenti ORF clone of Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1, mGFP tagged |
CNY 6370.00 |
|
RG219323 | CYP3A43 (tGFP-tagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 43 (CYP3A43), transcript variant 1 |
CNY 4940.00 |
其它CYP3A43产品