PRRX1 (NM_022716) Human Untagged Clone

CAT#: SC305044

PRRX1 (untagged)-Human paired related homeobox 1 (PRRX1), transcript variant pmx-1b



  "NM_022716" in other vectors (6)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PRRX1 mouse monoclonal antibody, clone OTI1E10 (formerly 1E10)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGOTC; PHOX1; PMX1; PRX-1; PRX1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305044 representing NM_022716.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCTCCAGCTACGGGCACGTTCTGGAGCGGCAACCGGCGCTGGGCGGCCGCTTGGACAGCCCGGGC
AACCTCGACACCCTGCAGGCGAAAAAGAACTTCTCCGTCAGTCACCTGCTAGACCTGGAGGAAGCCGGG
GACATGGTGGCGGCACAGGCGGATGAGAACGTGGGCGAGGCTGGCCGGAGCCTGCTGGAGTCGCCGGGA
CTCACCAGCGGCAGCGACACCCCGCAGCAGGACAATGACCAGCTGAACTCAGAAGAAAAAAAGAAGAGA
AAGCAGCGAAGGAATAGGACAACCTTCAATAGCAGCCAGCTGCAGGCTTTGGAGCGTGTCTTTGAGCGG
ACACACTATCCTGATGCTTTTGTGCGAGAAGACCTTGCCCGCCGGGTGAACCTCACCGAGGCGAGAGTG
CAGGTGTGGTTTCAGAACCGAAGAGCCAAGTTCCGCAGGAATGAGAGAGCCATGCTAGCCAATAAAAAC
GCTTCCCTCCTCAAATCCTACTCAGGAGACGTGACTGCTGTGGAGCAGCCCATCGTACCTCGTCCTGCT
CCGAGACCCACCGATTATCTCTCCTGGGGGACAGCGTCTCCGTACAGCGCCATGGCTACTTATTCTGCC
ACATGTGCCAACAATAGCCCTGCACAGGGCATCAACATGGCCAACAGCATTGCCAACCTGAGACTGAAG
GCCAAGGAATATAGTTTACAGAGGAACCAGGTGCCAACAGTCAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_022716
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022716.3
RefSeq Size 3999 bp
RefSeq ORF 738 bp
Locus ID 5396
UniProt ID P54821
Protein Families Transcription Factors
MW 27.3 kDa
Gene Summary The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (pmx-1b) encodes the longer isoform (pmx-1b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...