ICAM4 (NM_022377) Human Untagged Clone
CAT#: SC305020
ICAM4 (untagged)-Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD242; LW |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305020 representing NM_022377.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGTCTCTGTTCCCTCTGTCGCTGCTGTTTTTTTTGGCGGCCGCCTACCCGGGAGTTGGGAGCGCG CTGGGACGCCGGACTAAGCGGGCGCAAAGCCCCAAGGGTAGCCCTCTCGCGCCCTCCGGGACCTCAGTG CCCTTCTGGGTGCGCATGAGCCCGGAGTTCGTGGCTGTGCAGCCGGGGAAGTCAGTGCAGCTCAATTGC AGCAACAGCTGTCCCCAGCCGCAGAATTCCAGCCTCCGCACCCCGCTGCGGCAAGGCAAGACGCTCAGA GGGCCGGGTTGGGTGTCTTACCAGCTGCTCGACGTGAGGGCCTGGAGCTCCCTCGCGCACTGCCTCGTG ACCTGCGCAGGAAAAACACGCTGGGCCACCTCCAGGATCACCGCCTACAAACCGCCCCACAGCGTGATT TTGGAGCCTCCGGTCTTAAAGGGCAGGAAATACACTTTGCGCTGCCACGTGACGCAGGTGTTCCCGGTG GGCTACTTGGTGGTGACCCTGAGGCATGGAAGCCGGGTCATCTATTCCGAAAGCCTGGAGCGCTTCACC GGCCTGGATCTGGCCAACGTGACCTTGACCTACGAGTTTGCTGCTGGACCCCGCGACTTCTGGCAGCCC GTGATCTGCCACGCGCGCCTCAATCTCGACGGCCTGGTGGTCCGCAACAGCTCGGCACCCATTACACTG ATGCTCGGTGAGGCACCCCTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_022377 |
Insert Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022377.3 |
RefSeq Size | 1501 bp |
RefSeq ORF | 714 bp |
Locus ID | 3386 |
Protein Families | Secreted Protein, Transmembrane |
MW | 25.9 kDa |
Gene Summary | This gene encodes the Landsteiner-Wiener (LW) blood group antigen(s) that belongs to the immunoglobulin (Ig) superfamily, and that shares similarity with the intercellular adhesion molecule (ICAM) protein family. This ICAM protein contains 2 Ig-like C2-type domains and binds to the leukocyte adhesion LFA-1 protein. The molecular basis of the LW(A)/LW(B) blood group antigens is a single aa variation at position 100; Gln-100=LW(A) and Arg-100=LW(B). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes the intronic sequence between exons 2 and 3, which results in a frameshift and early translation termination, compared to variant 1. The encoded isoform (2) thus has the same N-terminus, but has a truncated C-terminus that lacks the transmembrane and cytoplasmic domains, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215092 | ICAM4 (Myc-DDK-tagged)-Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2 |
CNY 2400.00 |
|
RC215092L1 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC215092L2 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC215092L3 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215092L4 | Lenti ORF clone of Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG215092 | ICAM4 (tGFP-tagged) - Human intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) (ICAM4), transcript variant 2 |
CNY 4370.00 |