FXYD2 (NM_021603) Human Untagged Clone
CAT#: SC304942
FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP1G1; HOMG2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC304942 representing NM_021603.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACAGGTGGTACCTGGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACC GTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGA AGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021603 |
Insert Size | 195 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021603.3 |
RefSeq Size | 591 bp |
RefSeq ORF | 195 bp |
Locus ID | 486 |
UniProt ID | P54710 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
MW | 7.4 kDa |
Gene Summary | This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (b) contains an alternate 5' terminal exon compared to transcript variant a, resulting in a slightly shorter isoform (2) with a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202739 | FXYD2 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 1200.00 |
|
RC202739L1 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, Myc-DDK-tagged |
CNY 3600.00 |
|
RC202739L2 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, mGFP tagged |
CNY 5890.00 |
|
RC202739L3 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202739L4 | Lenti ORF clone of Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b, mGFP tagged |
CNY 5890.00 |
|
RG202739 | FXYD2 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 2800.00 |
|
SC320832 | FXYD2 (untagged)-Human FXYD domain containing ion transport regulator 2 (FXYD2), transcript variant b |
CNY 1200.00 |