CD79A (NM_021601) Human Untagged Clone
CAT#: SC304940
CD79A (untagged)-Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2
CNY 2400.00
CNY 3990.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IGA; MB-1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_021601 edited
ATGCCTGGGGGTCCAGGAGTCCTCCAAGCTCTGCCTGCCACCATCTTCCTCCTCTTCCTG CTGTCTGCTGTCTACCTGGGCCCTGGGTGCCAGGCCCTGTGGATGCACAAGGTCCCAGCA TCATTGATGGTGAGCCTGGGGGAAGACGCCCACTTCCAATGCCCGCACAATAGCAGCAAC AACGCCAACGTCACCTGGTGGCGCGTCCTCCATGGCAACTACACGTGGCCCCCTGAGTTC TTGGGCCCGGGCGAGGACCCCAATGAGCCGCCCCCCAGGCCCTTCCTGGACATGGGGGAG GGCACCAAGAACCGAATCATCACAGCCGAGGGGATCATCCTCCTGTTCTGCGCGGTGGTG CCTGGGACGCTGCTGCTGTTCAGGAAACGATGGCAGAACGAGAAGCTCGGGTTGGATGCC GGGGATGAATATGAAGATGAAAACCTTTATGAAGGCCTGAACCTGGACGACTGCTCCATG TATGAGGACATCTCCCGGGGCCTCCAGGGCACCTACCAGGATGTGGGCAGCCTCAACATA GGAGATGTCCAGCTGGAGAAGCCGTGACACCCCTACTCCTGCCAGGCTGCCCCCGCCTGC TGTGCACCCAGCTCCAGTGTCTCAGCTCACTTAAGGC |
Restriction Sites | Please inquire |
ACCN | NM_021601 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021601.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021601.2, NP_067612.1 |
RefSeq Size | 1132 bp |
RefSeq ORF | 567 bp |
Locus ID | 973 |
UniProt ID | P11912 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | B cell receptor signaling pathway, Primary immunodeficiency |
Gene Summary | The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215284 | CD79A (Myc-DDK-tagged)-Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2 |
CNY 2400.00 |
|
RC215284L3 | Lenti ORF clone of Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC215284L4 | Lenti ORF clone of Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG215284 | CD79A (tGFP-tagged) - Human CD79a molecule, immunoglobulin-associated alpha (CD79A), transcript variant 2 |
CNY 4370.00 |