alpha 5 Defensin (DEFA5) (NM_021010) Human Untagged Clone
CAT#: SC304891
DEFA5 (untagged)-Human defensin, alpha 5, Paneth cell-specific (DEFA5)
CNY 1200.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEF5; HD-5 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_021010 edited
TTCCACTCCTGCTCTCCCTCCTGCAGGTGACCCCAGCCATGAGGACCATCGCCATCCTTG CTGCCATTCTCCTGGTGGCCCTGCAGGCCCAGGCTGAGTCACTCCAGGAAAGAGCTGATG AGGCTACAACCCAGAAGCAGTCTGGGGAAGACAACCAGGACCTTGCTATCTCCTTTGCAG GAAATGGACTCTCTGCTCTTAGAACCTCAGGTTCTCAGGCAAGAGCCACCTGCTATTGCC GAACTGGCCGTTGTGCTACCC:GTGAGTCCCTCTCCGGGGTGTGTGAAATCAGTGGCCGC CTCTACAGACTCTGCTGTCGCTGAGCTTCCTAGATAGAAACCAAAGCAGTGCAAGATTCA GTTCAAGGTCCTGAAAAAAGAAAAACATTTTACTCTGTGTACCTTGTGTCTTTCTAAATT TCTCTCTCCAAAATAAAGTTCAAGCA |
Restriction Sites | Please inquire |
ACCN | NM_021010 |
Insert Size | 440 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021010.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021010.1, NP_066290.1 |
RefSeq Size | 449 bp |
RefSeq ORF | 285 bp |
Locus ID | 1670 |
UniProt ID | Q01523 |
Protein Families | Secreted Protein |
Gene Summary | Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Oct 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210219 | DEFA5 (Myc-DDK-tagged)-Human defensin, alpha 5, Paneth cell-specific (DEFA5) |
CNY 1200.00 |
|
RC210219L1 | Lenti ORF clone of Human defensin, alpha 5, Paneth cell-specific (DEFA5), Myc-DDK-tagged |
CNY 3600.00 |
|
RC210219L2 | Lenti ORF clone of Human defensin, alpha 5, Paneth cell-specific (DEFA5), mGFP tagged |
CNY 5890.00 |
|
RC210219L3 | Lenti ORF clone of Human defensin, alpha 5, Paneth cell-specific (DEFA5), Myc-DDK-tagged |
CNY 5890.00 |
|
RC210219L4 | Lenti ORF clone of Human defensin, alpha 5, Paneth cell-specific (DEFA5), mGFP tagged |
CNY 5890.00 |
|
RG210219 | DEFA5 (tGFP-tagged) - Human defensin, alpha 5, Paneth cell-specific (DEFA5) |
CNY 2800.00 |
其它alpha 5 Defensin产品