alpha 5 Defensin (DEFA5) (NM_021010) Human Untagged Clone

CAT#: SC304891

DEFA5 (untagged)-Human defensin, alpha 5, Paneth cell-specific (DEFA5)



  "NM_021010" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-DEFA5 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEF5; HD-5
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_021010 edited
TTCCACTCCTGCTCTCCCTCCTGCAGGTGACCCCAGCCATGAGGACCATCGCCATCCTTG
CTGCCATTCTCCTGGTGGCCCTGCAGGCCCAGGCTGAGTCACTCCAGGAAAGAGCTGATG
AGGCTACAACCCAGAAGCAGTCTGGGGAAGACAACCAGGACCTTGCTATCTCCTTTGCAG
GAAATGGACTCTCTGCTCTTAGAACCTCAGGTTCTCAGGCAAGAGCCACCTGCTATTGCC
GAACTGGCCGTTGTGCTACCC:GTGAGTCCCTCTCCGGGGTGTGTGAAATCAGTGGCCGC
CTCTACAGACTCTGCTGTCGCTGAGCTTCCTAGATAGAAACCAAAGCAGTGCAAGATTCA
GTTCAAGGTCCTGAAAAAAGAAAAACATTTTACTCTGTGTACCTTGTGTCTTTCTAAATT
TCTCTCTCCAAAATAAAGTTCAAGCA
Restriction Sites Please inquire     
ACCN NM_021010
Insert Size 440 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_021010.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_021010.1, NP_066290.1
RefSeq Size 449 bp
RefSeq ORF 285 bp
Locus ID 1670
UniProt ID Q01523
Protein Families Secreted Protein
Gene Summary Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Oct 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...