FGF22 (NM_020637) Human Untagged Clone

CAT#: SC304788

FGF22 (untagged)-Human fibroblast growth factor 22 (FGF22)



  "NM_020637" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-FGF22 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_020637 edited
CGCCACCATGCGCCGCCGCCTGTGGCTGGGCCTGGCCTGGCTGCTGCTGGCGCGGGCGCC
GGACGCCGCGGGAACCCCGAGCGCGTCGCGGGGACCGCGCAGCTACCCGCACCTGGAGGG
CGACGTGCGCTGGCGGCGCCTCTTCTCCTCCACTCACTTCTTCCTGCGCGTGGATCCCGG
CGGCCGCGTGCAGGGCACCCGCTGGCGCCACGGCCAGGACAGCATCCTGGAGATCCGCTC
TGTACACGTGGGCGTCGTGGTCATCAAAGCAGTGTCCTCAGGCTTCTACGTGGCCATGAA
CCGCCGGGGCCGCCTCTACGGGTCGCGACTCTACACCGTGGACTGCAGGTTCCGGGAGCG
CATCGAAGAGAACGGCCACAACACCTACGCCTCACAGCGCTGGCGCCGCCGCGGCCAGCC
CATGTTCCTGGCGCTGGACAGGAGGGGGGGGCCCCGGCCAGGCGGCCGGACGCGGCGGTA
CCACCTGTCCGCCCACTTCCTGCCCGTCCTGGTCTCCTGA
Restriction Sites Please inquire     
ACCN NM_020637
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It is not a varient.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_020637.1, NP_065688.1
RefSeq Size 513 bp
RefSeq ORF 513 bp
Locus ID 27006
UniProt ID Q9HCT0
Protein Families Secreted Protein
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The mouse homolog of this gene was found to be preferentially expressed in the inner root sheath of the hair follicle, which suggested a role in hair development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...