beta Arrestin 1 (ARRB1) (NM_020251) Human Untagged Clone
CAT#: SC304732
ARRB1 (untagged)-Human arrestin, beta 1 (ARRB1), transcript variant 2
CNY 5488.00
| Cited in 1 publication. |
Product images
CNY 1999.00
CNY 3600.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARB1; ARR1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_020251, the custom clone sequence may differ by one or more nucleotides
ATGGGCGACAAAGGGACCCGAGTGTTCAAGAAGGCCAGTCCAAATGGAAAGCTCACCGTCTACCTGGGAA AGCGGGACTTTGTGGACCACATCGACCTCGTGGACCCTGTGGATGGTGTGGTCCTGGTGGATCCTGAGTA TCTCAAAGAGCGGAGAGTCTATGTGACGCTGACCTGCGCCTTCCGCTATGGCCGGGAGGACCTGGATGTC CTGGGCCTGACCTTTCGCAAGGACCTGTTTGTGGCCAACGTACAGTCGTTCCCACCGGCCCCCGAGGACA AGAAGCCCCTGACGCGGCTGCAGGAACGCCTCATCAAGAAGCTGGGCGAGCACGCTTACCCTTTCACCTT TGAGATCCCTCCAAACCTTCCATGTTCTGTGACACTGCAGCCGGGGCCCGAAGACACGGGGAAGGCTTGC GGTGTGGACTATGAAGTCAAAGCCTTCTGCGCGGAGAATTTGGAGGAGAAGATCCACAAGCGGAATTCTG TGCGTCTGGTCATCCGGAAGGTTCAGTATGCCCCAGAGAGGCCTGGCCCCCAGCCCACAGCCGAGACCAC CAGGCAGTTCCTCATGTCGGACAAGCCCTTGCACCTAGAAGCCTCTCTGGATAAGGAGATCTATTACCAT GGAGAACCCATCAGCGTCAACGTCCACGTCACCAACAACACCAACAAGACGGTGAAGAAGATCAAGATCT CAGTGCGCCAGTATGCAGACATCTGCCTTTTCAACACAGCTCAGTACAAGTGCCCTGTTGCCATGGAAGA GGCTGATGACACTGTGGCACCCAGCTCGACGTTCTGCAAGGTCTACACACTGACCCCCTTCCTAGCCAAT AACCGAGAGAAGCGGGGCCTCGCCTTGGACGGGAAGCTCAAGCACGAAGACACGAACTTGGCCTCTAGCA CCCTGTTGAGGGAAGGTGCCAACCGTGAGATCCTGGGGATCATTGTTTCCTACAAAGTGAAAGTGAAGCT GGTGGTGTCTCGGGGCGGCGACGTGGCCGTGGAACTGCCCTTCACCCTAATGCACCCCAAGCCCAAAGAG GAACCCCCGCATCGGGAAGTTCCAGAGAACGAGACGCCAGTAGATACCAATCTCATAGAACTTGACACAA ATGATGACGACATTGTATTTGAGGACTTTGCTCGCCAGAGACTGAAAGGCATGAAGGATGACAAGGAGGA AGAGGAGGATGGTACCGGCTCTCCACAGCTCAACAACAGATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_020251 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020251.2, NP_064647.1 |
| RefSeq Size | 2180 bp |
| RefSeq ORF | 1233 bp |
| Locus ID | 408 |
| UniProt ID | P49407 |
| Protein Families | Druggable Genome |
| Protein Pathways | Chemokine signaling pathway, Endocytosis, MAPK signaling pathway |
| Gene Summary | Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 1 is a cytosolic protein and acts as a cofactor in the beta-adrenergic receptor kinase (BARK) mediated desensitization of beta-adrenergic receptors. Besides the central nervous system, it is expressed at high levels in peripheral blood leukocytes, and thus the BARK/beta-arrestin system is believed to play a major role in regulating receptor-mediated immune functions. Alternatively spliced transcripts encoding different isoforms of arrestin beta 1 have been described. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in a shorter protein (isoform B) compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Oxyntomodulin differentially affects Glucagon-Like Peptide-1 receptor beta-arrestin recruitment and signaling through G-alpha-s
,Rasmus Jorgensen, Valentina Kubale, Milka Vrecl, Thue W Schwartz, and Christian E Elling,
J Pharmacol Exp Ther. 2007 Jul;322(1):148-54.
[ARRB1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221737 | ARRB1 (Myc-DDK-tagged)-Human arrestin, beta 1 (ARRB1), transcript variant 2 |
CNY 5488.00 |
|
| RC221737L3 | Lenti ORF clone of Human arrestin, beta 1 (ARRB1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC221737L4 | Lenti ORF clone of Human arrestin, beta 1 (ARRB1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG221737 | ARRB1 (tGFP-tagged) - Human arrestin, beta 1 (ARRB1), transcript variant 2 |
CNY 7088.00 |
其它beta Arrestin 1产品

