IFNK (NM_020124) Human Untagged Clone
CAT#: SC304708
IFNK (untagged)-Human interferon, kappa (IFNK)
CNY 2,400.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IFNT1; INFE1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_020124 edited
CCACCATGAGCACCAAACCTGATATGATTCAAAAGTGTTTGTGGCTTGAGATCCTTATGG GTATATTCATTGCTGGCACCCTATCCCTGGACTGTAACTTACTGAACGTTCACCTGAGAA GAGTCACCTGGCAAAATCTGAGACATCTGAGTAGTATGAGCAATTCATTTCCTGTAGAAT GTCTACGAGAAAACATAGCTTTTGAGTTGCCCCAAGAGTTTCTGCAATACACCCAACCTA TGAAGAGGGACATCAAGAAGGCCTTCTATGAAATGTCCCTACAGGCCTTCAACATCTTCA GCCAACACACCTTCAAATATTGGAAAGAGAGACACCTCAAACAAATCCAAATAGGACTTG ATCAGCAAGCAGAGTACCTGAACCAATGCTTGGAGGAAGACAAGAATGAAAATGAAGACA TGAAAGAAATGAAAGAGAATGAGATGAAACCCTCAGAAGCCAGGGTCCCCCAGCTGAGCA GCCTGGAACTGAGGAGATATTTCCACAGGATAGACAATTTCCTGAAAGAAAAGAAATACA GTGACTGTGCCTGGGAGATTGTCCGAGTGGAAATCAGAAGATGTTTGTATTACTTTTACA AATTTACAGCTCTATTCAGGAGGAAATAA |
Restriction Sites | Please inquire |
ACCN | NM_020124 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_020124.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_020124.1, NP_064509.1 |
RefSeq Size | 1164 bp |
RefSeq ORF | 624 bp |
Locus ID | 56832 |
UniProt ID | Q9P0W0 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, RIG-I-like receptor signaling pathway |
Gene Summary | This gene encodes a member of the type I interferon family. Type I interferons are a group of related glycoproteins that play an important role in host defenses against viral infections. This protein is expressed in keratinocytes and the gene is found on chromosome 9, adjacent to the type I interferon cluster. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221055 | IFNK (Myc-DDK-tagged)-Human interferon, kappa (IFNK) |
CNY 2,400.00 |
|
RC221055L1 | Lenti-ORF clone of IFNK (Myc-DDK-tagged)-Human interferon, kappa (IFNK) |
CNY 5,890.00 |
|
RC221055L2 | Lenti-ORF clone of IFNK (mGFP-tagged)-Human interferon, kappa (IFNK) |
CNY 5,890.00 |
|
RC221055L3 | Lenti-ORF clone of IFNK (Myc-DDK-tagged)-Human interferon, kappa (IFNK) |
CNY 5,890.00 |
|
RC221055L4 | Lenti-ORF clone of IFNK (mGFP-tagged)-Human interferon, kappa (IFNK) |
CNY 5,890.00 |
|
RG221055 | IFNK (tGFP-tagged) - Human interferon, kappa (IFNK) |
CNY 4,000.00 |